ID: 1028343261

View in Genome Browser
Species Human (GRCh38)
Location 7:89748345-89748367
Sequence ATACATTTTATGTTCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028343261_1028343269 -1 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG No data
1028343261_1028343266 -4 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343266 7:89748364-89748386 GTATAGGGTGGGAGAGCTGTTGG No data
1028343261_1028343271 30 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343271 7:89748398-89748420 ATGGCTCCCTAAAAAGAGCCTGG No data
1028343261_1028343270 11 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343270 7:89748379-89748401 GCTGTTGGGGGTAAACAGCATGG No data
1028343261_1028343267 -3 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343267 7:89748365-89748387 TATAGGGTGGGAGAGCTGTTGGG No data
1028343261_1028343268 -2 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343268 7:89748366-89748388 ATAGGGTGGGAGAGCTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028343261 Original CRISPR ATACATTTTATGTTCTCCTC AGG (reversed) Intergenic
No off target data available for this crispr