ID: 1028343269

View in Genome Browser
Species Human (GRCh38)
Location 7:89748367-89748389
Sequence TAGGGTGGGAGAGCTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028343259_1028343269 15 Left 1028343259 7:89748329-89748351 CCAGCTGGCAATAGAACCTGAGG No data
Right 1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG No data
1028343261_1028343269 -1 Left 1028343261 7:89748345-89748367 CCTGAGGAGAACATAAAATGTAT No data
Right 1028343269 7:89748367-89748389 TAGGGTGGGAGAGCTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028343269 Original CRISPR TAGGGTGGGAGAGCTGTTGG GGG Intergenic
No off target data available for this crispr