ID: 1028346747

View in Genome Browser
Species Human (GRCh38)
Location 7:89793012-89793034
Sequence GGCTAGTCAGTTATTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028346744_1028346747 -1 Left 1028346744 7:89792990-89793012 CCAGATTCAACATTCTGCATGGG No data
Right 1028346747 7:89793012-89793034 GGCTAGTCAGTTATTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028346747 Original CRISPR GGCTAGTCAGTTATTGCAAC AGG Intergenic