ID: 1028346997

View in Genome Browser
Species Human (GRCh38)
Location 7:89795396-89795418
Sequence AGCTGCTTGCAGTAGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028346994_1028346997 8 Left 1028346994 7:89795365-89795387 CCACTTCTAGGTTTTCCAGCTTC No data
Right 1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG No data
1028346995_1028346997 -7 Left 1028346995 7:89795380-89795402 CCAGCTTCTGTCATAGAGCTGCT No data
Right 1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG No data
1028346992_1028346997 20 Left 1028346992 7:89795353-89795375 CCAGGAATGTATCCACTTCTAGG No data
Right 1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028346997 Original CRISPR AGCTGCTTGCAGTAGTCTGA GGG Intergenic
No off target data available for this crispr