ID: 1028351589

View in Genome Browser
Species Human (GRCh38)
Location 7:89856814-89856836
Sequence GAGAATCCCCCAGCACTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028351585_1028351589 12 Left 1028351585 7:89856779-89856801 CCAGATTTACAAAACTTGGTGGA No data
Right 1028351589 7:89856814-89856836 GAGAATCCCCCAGCACTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028351589 Original CRISPR GAGAATCCCCCAGCACTCGT GGG Intergenic
No off target data available for this crispr