ID: 1028357920

View in Genome Browser
Species Human (GRCh38)
Location 7:89931838-89931860
Sequence CAGTGGTATTGGAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028357920_1028357926 27 Left 1028357920 7:89931838-89931860 CCATTTTCCTTCCAATACCACTG No data
Right 1028357926 7:89931888-89931910 CAACATTATTCAAAATATTTGGG No data
1028357920_1028357925 26 Left 1028357920 7:89931838-89931860 CCATTTTCCTTCCAATACCACTG No data
Right 1028357925 7:89931887-89931909 ACAACATTATTCAAAATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028357920 Original CRISPR CAGTGGTATTGGAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr