ID: 1028359602

View in Genome Browser
Species Human (GRCh38)
Location 7:89952045-89952067
Sequence CAGCTGTGATGGTTCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028359602_1028359608 5 Left 1028359602 7:89952045-89952067 CCTGTTTTGAACCATCACAGCTG No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data
1028359602_1028359606 -8 Left 1028359602 7:89952045-89952067 CCTGTTTTGAACCATCACAGCTG No data
Right 1028359606 7:89952060-89952082 CACAGCTGTCCTGGGTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028359602 Original CRISPR CAGCTGTGATGGTTCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr