ID: 1028359608

View in Genome Browser
Species Human (GRCh38)
Location 7:89952073-89952095
Sequence GGTACAAAGGAGTCAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028359605_1028359608 -6 Left 1028359605 7:89952056-89952078 CCATCACAGCTGTCCTGGGTACA No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data
1028359602_1028359608 5 Left 1028359602 7:89952045-89952067 CCTGTTTTGAACCATCACAGCTG No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data
1028359601_1028359608 6 Left 1028359601 7:89952044-89952066 CCCTGTTTTGAACCATCACAGCT No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data
1028359599_1028359608 29 Left 1028359599 7:89952021-89952043 CCAGAATCTCTGTGCCTTTTTTT No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data
1028359600_1028359608 15 Left 1028359600 7:89952035-89952057 CCTTTTTTTCCCTGTTTTGAACC No data
Right 1028359608 7:89952073-89952095 GGTACAAAGGAGTCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028359608 Original CRISPR GGTACAAAGGAGTCAGTGCC AGG Intergenic
No off target data available for this crispr