ID: 1028363909

View in Genome Browser
Species Human (GRCh38)
Location 7:90005006-90005028
Sequence CTGTAGAGACAGATAAAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028363907_1028363909 6 Left 1028363907 7:90004977-90004999 CCAAGGATTCAGAGAAAGCTTAA No data
Right 1028363909 7:90005006-90005028 CTGTAGAGACAGATAAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028363909 Original CRISPR CTGTAGAGACAGATAAAGCG TGG Intergenic
No off target data available for this crispr