ID: 1028364602

View in Genome Browser
Species Human (GRCh38)
Location 7:90012877-90012899
Sequence ATGTGGGGCCCTGTTTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028364602_1028364608 -5 Left 1028364602 7:90012877-90012899 CCTAGATAAACAGGGCCCCACAT No data
Right 1028364608 7:90012895-90012917 CACATGAATGGGAAATTCTGTGG No data
1028364602_1028364611 25 Left 1028364602 7:90012877-90012899 CCTAGATAAACAGGGCCCCACAT No data
Right 1028364611 7:90012925-90012947 AGAAAGTAAATGGCAAAACTAGG No data
1028364602_1028364610 15 Left 1028364602 7:90012877-90012899 CCTAGATAAACAGGGCCCCACAT No data
Right 1028364610 7:90012915-90012937 TGGGTACGTCAGAAAGTAAATGG No data
1028364602_1028364609 -4 Left 1028364602 7:90012877-90012899 CCTAGATAAACAGGGCCCCACAT No data
Right 1028364609 7:90012896-90012918 ACATGAATGGGAAATTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028364602 Original CRISPR ATGTGGGGCCCTGTTTATCT AGG (reversed) Intergenic
No off target data available for this crispr