ID: 1028365203

View in Genome Browser
Species Human (GRCh38)
Location 7:90021119-90021141
Sequence TCTACCTCACAGAATTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028365196_1028365203 5 Left 1028365196 7:90021091-90021113 CCTGTTAAATGTTAAGGATACCC No data
Right 1028365203 7:90021119-90021141 TCTACCTCACAGAATTATGAGGG No data
1028365194_1028365203 16 Left 1028365194 7:90021080-90021102 CCATTTTCTCACCTGTTAAATGT No data
Right 1028365203 7:90021119-90021141 TCTACCTCACAGAATTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028365203 Original CRISPR TCTACCTCACAGAATTATGA GGG Intergenic
No off target data available for this crispr