ID: 1028373430

View in Genome Browser
Species Human (GRCh38)
Location 7:90119629-90119651
Sequence TACCTCCGGCTCCGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 96}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028373430_1028373449 28 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373449 7:90119680-90119702 GCGGGAGGTCCTTCCGGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 49
1028373430_1028373442 9 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373442 7:90119661-90119683 GAAAAGTCGGCCCTAGGCGGCGG No data
1028373430_1028373439 -4 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373439 7:90119648-90119670 GGTAGAGGAGGTGGAAAAGTCGG 0: 1
1: 0
2: 10
3: 118
4: 1610
1028373430_1028373444 13 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373444 7:90119665-90119687 AGTCGGCCCTAGGCGGCGGGAGG 0: 1
1: 0
2: 1
3: 3
4: 66
1028373430_1028373447 22 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373447 7:90119674-90119696 TAGGCGGCGGGAGGTCCTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1028373430_1028373443 10 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373443 7:90119662-90119684 AAAAGTCGGCCCTAGGCGGCGGG No data
1028373430_1028373440 3 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373440 7:90119655-90119677 GAGGTGGAAAAGTCGGCCCTAGG No data
1028373430_1028373441 6 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373441 7:90119658-90119680 GTGGAAAAGTCGGCCCTAGGCGG No data
1028373430_1028373448 25 Left 1028373430 7:90119629-90119651 CCTCCGCCCCGGAGCCGGAGGTA 0: 1
1: 0
2: 3
3: 13
4: 96
Right 1028373448 7:90119677-90119699 GCGGCGGGAGGTCCTTCCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028373430 Original CRISPR TACCTCCGGCTCCGGGGCGG AGG (reversed) Intergenic