ID: 1028374662

View in Genome Browser
Species Human (GRCh38)
Location 7:90133825-90133847
Sequence CCCTCCTACTCACCTTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028374662_1028374672 8 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374672 7:90133856-90133878 GTGAAAGAGGAGGGATATGGAGG No data
1028374662_1028374676 28 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374676 7:90133876-90133898 AGGGAAAAGGACATAAGTGGTGG No data
1028374662_1028374675 25 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374675 7:90133873-90133895 TGGAGGGAAAAGGACATAAGTGG No data
1028374662_1028374670 -1 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374670 7:90133847-90133869 GGAGGGATGGTGAAAGAGGAGGG No data
1028374662_1028374674 15 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374674 7:90133863-90133885 AGGAGGGATATGGAGGGAAAAGG No data
1028374662_1028374669 -2 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374669 7:90133846-90133868 GGGAGGGATGGTGAAAGAGGAGG No data
1028374662_1028374668 -5 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374668 7:90133843-90133865 GAGGGGAGGGATGGTGAAAGAGG No data
1028374662_1028374673 9 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374673 7:90133857-90133879 TGAAAGAGGAGGGATATGGAGGG No data
1028374662_1028374671 5 Left 1028374662 7:90133825-90133847 CCTGAAGAAGGTGAGTAGGAGGG No data
Right 1028374671 7:90133853-90133875 ATGGTGAAAGAGGAGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028374662 Original CRISPR CCCTCCTACTCACCTTCTTC AGG (reversed) Intergenic