ID: 1028378603

View in Genome Browser
Species Human (GRCh38)
Location 7:90174212-90174234
Sequence CTGATGTGAATCATCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3298
Summary {0: 1, 1: 0, 2: 14, 3: 306, 4: 2977}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378606 -2 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378606 7:90174233-90174255 AGTAATCTCAACAATTTGGGAGG 0: 1
1: 69
2: 3004
3: 51995
4: 372609
1028378603_1028378607 4 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378607 7:90174239-90174261 CTCAACAATTTGGGAGGCCTAGG No data
1028378603_1028378604 -6 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378604 7:90174229-90174251 CATCAGTAATCTCAACAATTTGG No data
1028378603_1028378610 27 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378610 7:90174262-90174284 TAAGAGAATTGCTTGAGGCCAGG 0: 5
1: 108
2: 1779
3: 15965
4: 91150
1028378603_1028378609 22 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378609 7:90174257-90174279 CTAGGTAAGAGAATTGCTTGAGG 0: 1
1: 1
2: 76
3: 814
4: 4241
1028378603_1028378605 -5 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378605 7:90174230-90174252 ATCAGTAATCTCAACAATTTGGG 0: 1
1: 7
2: 123
3: 2521
4: 27128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378603 Original CRISPR CTGATGTGAATCATCATGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr