ID: 1028378604

View in Genome Browser
Species Human (GRCh38)
Location 7:90174229-90174251
Sequence CATCAGTAATCTCAACAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378604 -6 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378604 7:90174229-90174251 CATCAGTAATCTCAACAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378604 Original CRISPR CATCAGTAATCTCAACAATT TGG Intronic
No off target data available for this crispr