ID: 1028378605

View in Genome Browser
Species Human (GRCh38)
Location 7:90174230-90174252
Sequence ATCAGTAATCTCAACAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29780
Summary {0: 1, 1: 7, 2: 123, 3: 2521, 4: 27128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378605 -5 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378605 7:90174230-90174252 ATCAGTAATCTCAACAATTTGGG 0: 1
1: 7
2: 123
3: 2521
4: 27128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378605 Original CRISPR ATCAGTAATCTCAACAATTT GGG Intronic
Too many off-targets to display for this crispr