ID: 1028378606

View in Genome Browser
Species Human (GRCh38)
Location 7:90174233-90174255
Sequence AGTAATCTCAACAATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427678
Summary {0: 1, 1: 69, 2: 3004, 3: 51995, 4: 372609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378606 -2 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378606 7:90174233-90174255 AGTAATCTCAACAATTTGGGAGG 0: 1
1: 69
2: 3004
3: 51995
4: 372609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378606 Original CRISPR AGTAATCTCAACAATTTGGG AGG Intronic
Too many off-targets to display for this crispr