ID: 1028378609

View in Genome Browser
Species Human (GRCh38)
Location 7:90174257-90174279
Sequence CTAGGTAAGAGAATTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5133
Summary {0: 1, 1: 1, 2: 76, 3: 814, 4: 4241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378609 22 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378609 7:90174257-90174279 CTAGGTAAGAGAATTGCTTGAGG 0: 1
1: 1
2: 76
3: 814
4: 4241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378609 Original CRISPR CTAGGTAAGAGAATTGCTTG AGG Intronic
Too many off-targets to display for this crispr