ID: 1028378610

View in Genome Browser
Species Human (GRCh38)
Location 7:90174262-90174284
Sequence TAAGAGAATTGCTTGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109007
Summary {0: 5, 1: 108, 2: 1779, 3: 15965, 4: 91150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028378603_1028378610 27 Left 1028378603 7:90174212-90174234 CCAGGCATGATGATTCACATCAG 0: 1
1: 0
2: 14
3: 306
4: 2977
Right 1028378610 7:90174262-90174284 TAAGAGAATTGCTTGAGGCCAGG 0: 5
1: 108
2: 1779
3: 15965
4: 91150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028378610 Original CRISPR TAAGAGAATTGCTTGAGGCC AGG Intronic
Too many off-targets to display for this crispr