ID: 1028379400

View in Genome Browser
Species Human (GRCh38)
Location 7:90182051-90182073
Sequence CTGAATATATACAGTGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028379397_1028379400 -8 Left 1028379397 7:90182036-90182058 CCAATTTCCAACATCCTGAATAT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG 0: 1
1: 1
2: 2
3: 25
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028379400 Original CRISPR CTGAATATATACAGTGACAG AGG Intronic
902847168 1:19120643-19120665 CTGAACAAATACAGTGACACTGG + Intronic
907367968 1:53978360-53978382 CTCAATATATACATAGAGAGAGG - Intergenic
907606726 1:55825673-55825695 CTTAATATTTACAGTCCCAGAGG - Intergenic
907795777 1:57715382-57715404 CTGAATAAAAGCAGTGAAAGTGG - Intronic
908676259 1:66607604-66607626 CTGGATATATTCTGTGACAGGGG + Intronic
908948478 1:69528470-69528492 CTGAATAAATAAAATGACCGTGG + Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909430982 1:75587657-75587679 CTTAATATATACTTTGAAAGAGG - Intronic
910619597 1:89237781-89237803 CTGAAAATCTCCAGTGACTGGGG + Intergenic
910863405 1:91765180-91765202 AGGAATTTATACTGTGACAGGGG - Intronic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
911828285 1:102516058-102516080 CTGAATAGATATAGTGATTGGGG + Intergenic
912036449 1:105323197-105323219 TTGAAAATATACAATAACAGGGG - Intergenic
912116086 1:106410503-106410525 TTGAATATATTCAGTGATAGAGG - Intergenic
916098019 1:161368558-161368580 CTGATTCTAGACAGTGACAGAGG - Exonic
917588218 1:176450206-176450228 CTGAGTATCTACAGTGCTAGAGG + Intergenic
918323346 1:183385517-183385539 TTGCATATATTCTGTGACAGGGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921370816 1:214421426-214421448 TTGAAATTAGACAGTGACAGTGG + Intronic
923732209 1:236563109-236563131 CTGAATAGAAACAATGACAGAGG + Intronic
923972138 1:239216623-239216645 CTAAATATATAACGTGGCAGGGG - Intergenic
924870244 1:248035100-248035122 CTGAATAGATGCCGTGAAAGTGG + Intronic
1063010465 10:2017299-2017321 ATGCATACACACAGTGACAGAGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068816058 10:61314490-61314512 CTGAATATATAAGGTGCCACTGG - Intergenic
1069301644 10:66915318-66915340 CTGATTCTCTACAGTGACAGTGG + Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1071533163 10:86404286-86404308 CTGAATAGAGATAGTGATAGAGG - Intergenic
1072020908 10:91400020-91400042 CTGAATAGAAATGGTGACAGTGG - Intergenic
1072760843 10:98055256-98055278 CTGCAAGTATACAGTGGCAGGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1079521406 11:21331404-21331426 CTGAATAAATTTAGTGACACTGG + Intronic
1085012568 11:73151536-73151558 CCCAATATACAGAGTGACAGAGG - Intergenic
1085491707 11:76925388-76925410 CTGAATGTTTACAGTTATAGAGG + Intronic
1086500593 11:87449198-87449220 CTGAATTGATGCAGTGACAAAGG + Intergenic
1087620931 11:100540875-100540897 CTGAACTAATACAGTGGCAGTGG - Intergenic
1087690881 11:101319496-101319518 TTGAAAATATACAGTTAGAGGGG - Intergenic
1087856907 11:103103274-103103296 CTGAAAATATACAGGGAAAGAGG - Intergenic
1088224960 11:107609826-107609848 CTCAATGTATACAGGGACATTGG - Intronic
1090694614 11:129226173-129226195 TTGCATACATACAGTGAGAGGGG + Intronic
1092610696 12:10169168-10169190 CTGAAGACCTAGAGTGACAGAGG + Exonic
1096183471 12:49563986-49564008 CTGAAGACATTAAGTGACAGAGG + Intronic
1096933829 12:55246544-55246566 CAGAATATTTGCAGTGACAGAGG - Intergenic
1099639228 12:85263519-85263541 CTGAAAATAAACAGTGACAAAGG + Intergenic
1099788662 12:87301203-87301225 CTGAATAGCTACAGAGACATAGG + Intergenic
1099899277 12:88687538-88687560 CTGAATAGAAATAGTGAGAGTGG + Intergenic
1100114903 12:91292730-91292752 CTGAATACGTATGGTGACAGTGG + Intergenic
1100250828 12:92821586-92821608 CTGAGTATATACTGTGATGGAGG - Intronic
1100460224 12:94792428-94792450 CTGAATGTAGACAGTACCAGGGG + Intergenic
1101588223 12:106103478-106103500 CTGAATATGTCCAGTGAATGAGG - Intronic
1104572927 12:129941125-129941147 TTAAATATATACAATGACATTGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107818505 13:44265793-44265815 ATAAATATATACAAAGACAGAGG + Intergenic
1109435999 13:62303514-62303536 TTGAATAGATATAGTGAGAGAGG + Intergenic
1110031444 13:70619510-70619532 TTGAATATTTTCTGTGACAGTGG + Intergenic
1111828308 13:93296299-93296321 CTAAACAAAGACAGTGACAGTGG - Intronic
1111918411 13:94385273-94385295 CTGAAAAGGTACAGTGACTGGGG + Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112762037 13:102702365-102702387 CTAAATAGGAACAGTGACAGTGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115160162 14:30384796-30384818 CTGAATTAAGACAGTGACATTGG + Intergenic
1115675178 14:35665566-35665588 CTGAATAAATACTGTAATAGAGG + Intronic
1116990613 14:51272090-51272112 CTTAATATATACACTTATAGCGG - Intergenic
1119482155 14:74964715-74964737 CTGAATCAAGACAGTGACCGTGG + Intergenic
1120332678 14:83113830-83113852 CTGAATGTGTACAGTTACAAAGG - Intergenic
1120412508 14:84175423-84175445 CTGAGTAGATACAGTAATAGAGG - Intergenic
1120478362 14:85018261-85018283 CTTAATATTTACAGAGAAAGAGG + Intergenic
1120864083 14:89280684-89280706 CAGAATATGAACAGTGACGGCGG + Intronic
1123472177 15:20563273-20563295 CTTAACATAAACACTGACAGCGG + Intergenic
1123645825 15:22437080-22437102 CTTAACATAAACATTGACAGCGG - Intergenic
1124563017 15:30792353-30792375 CTTAACATAGACACTGACAGTGG + Intergenic
1124912495 15:33936160-33936182 CTGAATAGAGGCAGTGATAGAGG - Intronic
1125571300 15:40720440-40720462 CTGAATGTAAATAGTGAAAGTGG - Intronic
1128178107 15:65574851-65574873 CTGAATTTATACAGTAATAAAGG - Intronic
1130260172 15:82348518-82348540 CTTAACATAGACATTGACAGTGG - Intronic
1130268559 15:82430915-82430937 CTTAACATAGACATTGACAGTGG + Intronic
1130281061 15:82520489-82520511 CTCAACATAGACATTGACAGTGG + Intergenic
1130472432 15:84236670-84236692 CTTAACATAGACATTGACAGTGG + Intronic
1130479923 15:84351241-84351263 CTTAACATAGACATTGACAGTGG + Intergenic
1130491847 15:84436888-84436910 CTTAACATAGACATTGACAGTGG - Intergenic
1130503461 15:84515928-84515950 CTTAACATAGACATTGACAGTGG - Intergenic
1130594729 15:85241306-85241328 CTCAACATAGACATTGACAGTGG + Intergenic
1132011367 15:98279521-98279543 TTGAACATTTTCAGTGACAGGGG - Intergenic
1132289901 15:100692650-100692672 CTGCATTTATCCAGTGACATGGG - Intergenic
1132433826 15:101781167-101781189 CTTAACATAGACATTGACAGTGG - Intergenic
1134515157 16:14881200-14881222 CTGAATATATGGAGTGAAAGAGG + Intronic
1134702832 16:16279845-16279867 CTGAATATATGGAATGAAAGAGG + Intronic
1134964711 16:18432270-18432292 CTGAATATATGGAATGAAAGAGG - Intronic
1134968998 16:18514805-18514827 CTGAATATATGGAATGAAAGAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137659294 16:50190398-50190420 CTGAAACTAGACAGTAACAGTGG - Intronic
1137710305 16:50562297-50562319 CTGCAGATACACAGTGACACAGG - Intronic
1139208059 16:65048175-65048197 CTGAATGTATCCAGTGAGTGAGG - Intronic
1140689529 16:77468264-77468286 CTGAATATATACAGTAACTCAGG - Intergenic
1140892515 16:79297360-79297382 ATGAATATCTACGGTGACTGTGG + Intergenic
1141060748 16:80866563-80866585 GTGAATAGAAGCAGTGACAGTGG - Intergenic
1144613633 17:16747956-16747978 TTGAATACATACGGTGAGAGTGG + Intronic
1144899081 17:18567706-18567728 TTGAATACATACGGTGAGAGTGG - Intergenic
1145133294 17:20378008-20378030 TTGAATACATACAGTGAGAGTGG + Intergenic
1147207336 17:38847032-38847054 CAGAATATAAACAGTGACAAAGG + Intergenic
1148664877 17:49366951-49366973 CTGTACATATACAGGGTCAGCGG + Intergenic
1149050017 17:52293090-52293112 ATGAATATTTACACTGACTGTGG - Intergenic
1149876195 17:60235489-60235511 CTGATAATAAGCAGTGACAGAGG + Intronic
1151068211 17:71176990-71177012 CAGACTATAAACAGTAACAGTGG - Intergenic
1153326261 18:3823313-3823335 ATTAATATATTCAGTGAGAGAGG - Intronic
1153367795 18:4277779-4277801 CAAAATACATAAAGTGACAGTGG - Intronic
1155330139 18:24707387-24707409 CTTAATATCTACTGTCACAGAGG - Intergenic
1155632769 18:27913864-27913886 CTGAATATATCCTGTGATTGTGG - Intergenic
1156605593 18:38663453-38663475 ATAAATATAGAAAGTGACAGAGG + Intergenic
1156794378 18:41024950-41024972 CTGGATTTATGCAGTGTCAGGGG - Intergenic
1159039230 18:63307633-63307655 ATGAATACATCCAGTGACAGTGG - Intronic
1159610315 18:70517948-70517970 CTAAATCTGTACACTGACAGTGG - Intergenic
1161130894 19:2587979-2588001 CTGAATAGAAACAGTGAGAGTGG - Intronic
925232688 2:2248970-2248992 TTGAATAACAACAGTGACAGTGG - Intronic
926582711 2:14648926-14648948 CTGACTTTACCCAGTGACAGGGG - Intronic
926875450 2:17471741-17471763 CTGAATATAAGAAGTGACAGTGG + Intergenic
927399320 2:22692721-22692743 ATGAATATACACAGTGAGTGAGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929463219 2:42121326-42121348 CTGAATAAATATAGTGACAGTGG + Intergenic
929764761 2:44834918-44834940 CTGAAAATCTAGAGTGTCAGAGG + Intergenic
930450445 2:51529824-51529846 TTGAATAGATACAGTGAAAGTGG + Intergenic
930566113 2:53022615-53022637 TTGCATATCTACAGTTACAGTGG - Intergenic
931128432 2:59303674-59303696 CTGCATAAATATAGTGAAAGAGG + Intergenic
931295942 2:60926038-60926060 ATGAATATATGTAGAGACAGAGG - Exonic
932993146 2:76812891-76812913 CTGAATTTATACATTGAAATAGG + Intronic
936557425 2:113508662-113508684 CTGAATATCTAGGGTGAGAGAGG - Intergenic
936912310 2:117605518-117605540 ATGAAAATGTCCAGTGACAGTGG + Intergenic
937628199 2:124067946-124067968 CTGGATATATACAGTCATATTGG + Intronic
938583019 2:132664723-132664745 TTGACTAGATACAGTGAAAGGGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939716561 2:145591212-145591234 GTGAATATATACCGTGAGATAGG + Intergenic
940990455 2:160091179-160091201 CTGAAGAAAGACAGTGTCAGTGG - Intergenic
941830946 2:169958959-169958981 TAGAATTTATACAGTGAGAGAGG + Intronic
942689659 2:178572089-178572111 CTGAATTAATCCAGTGATAGTGG + Exonic
943082609 2:183273933-183273955 CTGAATATAAATGGTGACAGTGG + Intergenic
943188854 2:184650413-184650435 CTGAATATGAGCAGTGAAAGTGG - Intronic
943367357 2:186979087-186979109 CTTAATGTTTAAAGTGACAGTGG + Intergenic
943948053 2:194092785-194092807 CTGAAAATATGCATTGACAATGG - Intergenic
944816537 2:203382728-203382750 CAGAAAATATTCAGTGACACGGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945652407 2:212579690-212579712 ATGAATCTTTAAAGTGACAGAGG + Intergenic
946062941 2:216960460-216960482 TGAAATATATACAGTGAAAGGGG + Intergenic
946182268 2:217955813-217955835 TTGAATATTTTCAGTGACACTGG + Intronic
1169422287 20:5470406-5470428 CTGAGTGTATACAGGGACATTGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1173827612 20:46057676-46057698 CTGTATGTAAACGGTGACAGCGG - Exonic
1175308827 20:57997163-57997185 CAGAATGTTTACAGTGGCAGGGG + Intergenic
1177627828 21:23687208-23687230 CTGCTTAAAAACAGTGACAGAGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178229770 21:30768564-30768586 TTGAATATATACAGAAAAAGAGG + Intergenic
1184754783 22:46509631-46509653 CTGAATATCAGCAGTGCCAGCGG + Intronic
951168152 3:19507056-19507078 CTGAACATTTCCAGTGGCAGGGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952068524 3:29603112-29603134 CAGAAGATATACAGTGGGAGTGG - Intronic
952080870 3:29755921-29755943 CTTAATTTATACAGGGAGAGTGG - Intronic
953495597 3:43383872-43383894 CTGAATAGAAATAGTGAAAGTGG - Intronic
955082948 3:55674767-55674789 CTGCATATACACAGTGACTGAGG + Intronic
957115892 3:76025991-76026013 CAGAATAAATACAGTGAGATTGG - Intronic
958808151 3:98836277-98836299 CTGATTGTTTACAGTGGCAGAGG + Intronic
959050650 3:101521677-101521699 CTGAATATATGAAGAGACAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961512438 3:127411293-127411315 CTGAGCATCTACAGGGACAGGGG + Intergenic
962514638 3:136139097-136139119 CTGACTATTTACAGGGACAAAGG - Intronic
963193143 3:142495911-142495933 CTGAATATTTACAGTAACACTGG + Intronic
963434512 3:145250817-145250839 ATAAATATATAAAGAGACAGAGG - Intergenic
964995818 3:162879070-162879092 ATGAAAATATTCAGTGAAAGTGG + Intergenic
965659203 3:171022853-171022875 CTGTGTATGTAAAGTGACAGGGG - Intronic
965916205 3:173849472-173849494 CTGAATATAAACATTAGCAGAGG + Intronic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969038005 4:4271516-4271538 CTGAATATATACCCAAACAGTGG + Intronic
970215869 4:13759663-13759685 TTGAAGATATAGAGTGAAAGGGG + Intergenic
970385538 4:15553002-15553024 CTGAAGAAATTCAGTGACACTGG + Intronic
971048757 4:22836105-22836127 TTGAATAGAAACAGTGAGAGTGG - Intergenic
971204881 4:24555743-24555765 CTTAATCAATACAGTAACAGGGG + Intronic
971777927 4:30992317-30992339 CTGAATATCAACAGTGCCACTGG + Intronic
972948696 4:44291142-44291164 CTGAATATATATTGTGTCTGTGG - Intronic
973304282 4:48627297-48627319 CTTAATATTTACAGTGAAAAGGG - Intronic
973753576 4:54048694-54048716 CTGTATCTGTACATTGACAGTGG - Intronic
974432336 4:61815544-61815566 ATGAATAGATACAGGGAAAGGGG + Intronic
974907759 4:68078245-68078267 ATGAATGTACACAGTCACAGAGG - Intronic
977454307 4:97238243-97238265 CTGAAGACGTACAGTGAAAGAGG + Intronic
977713647 4:100156120-100156142 CTGAATAGAAGCAGTGAGAGAGG + Intergenic
977751173 4:100611371-100611393 CTGAATAGAAATAGTGAAAGTGG + Intronic
978485125 4:109244721-109244743 CTAAACATATACAATCACAGAGG + Intronic
979072435 4:116225068-116225090 GTTAAAATATGCAGTGACAGTGG + Intergenic
982136052 4:152275367-152275389 CTGCATCAATACAGTGACAGCGG + Intergenic
982407632 4:155037727-155037749 ATGAATGTATACAGAGCCAGAGG - Intergenic
982676337 4:158380526-158380548 CTGTATATAAACAATGATAGTGG + Intronic
983107431 4:163706059-163706081 CTGAATATACACCTTCACAGTGG + Intronic
983942415 4:173549222-173549244 GTGACTATACACAGTGGCAGTGG + Intergenic
984449405 4:179879964-179879986 ATGAATATAAAAAGTGACATTGG - Intergenic
984518945 4:180776932-180776954 ATGATTATATATAGTGACAATGG - Intergenic
988698464 5:33648312-33648334 CTGAATTGAGGCAGTGACAGTGG + Intronic
989329182 5:40235522-40235544 CTACTTATATTCAGTGACAGAGG + Intergenic
990840173 5:60070218-60070240 CTGAATAGAAGCAGTGAAAGTGG + Intronic
991044643 5:62210245-62210267 CTGAAAATATTCAGTGATAAAGG - Intergenic
993138713 5:84002953-84002975 CTGAACATTTCCACTGACAGAGG + Intronic
995508662 5:112885971-112885993 CTGGATGTTTACAGTGACTGTGG + Intronic
996066069 5:119080650-119080672 ATGATTAAATACAGGGACAGAGG - Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999993943 5:157073997-157074019 GTGAATGCATAAAGTGACAGAGG - Intergenic
1000252484 5:159508846-159508868 CAGAACTAATACAGTGACAGAGG - Intergenic
1004555619 6:16694766-16694788 TTGAACATCTCCAGTGACAGAGG + Intronic
1004868836 6:19882429-19882451 CTGTTTATATACAGATACAGAGG + Intergenic
1005617869 6:27592725-27592747 CTGAAGACCTACAGTGACCGAGG - Intergenic
1005801866 6:29433671-29433693 TTGAATATATACACAGACAAGGG + Intronic
1006545233 6:34775322-34775344 CTGAATATGAACAGTGCCAATGG - Intergenic
1008940687 6:57042296-57042318 ATGAAAATATACAGTCAGAGAGG + Intergenic
1009730612 6:67599902-67599924 CTGAATAAAAGCAGTGAAAGTGG + Intergenic
1011741655 6:90367035-90367057 ATGAATATATATAGAGAGAGAGG - Intergenic
1012004059 6:93690784-93690806 CTGCATACACACAGTGGCAGGGG + Intergenic
1012614242 6:101256383-101256405 CTAAATATATGCTGTGTCAGTGG + Intergenic
1014335853 6:120135444-120135466 CTGAAAATATATAATGAAAGAGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015479509 6:133692324-133692346 CTGAATAAATACAGTTTAAGAGG + Intergenic
1016194622 6:141318502-141318524 TTGAAAATATACAGTCAGAGGGG + Intergenic
1018021950 6:159769680-159769702 CTGGGTAGAGACAGTGACAGTGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018513427 6:164551830-164551852 CTGAATATTTATAGGGGCAGAGG - Intergenic
1018514084 6:164559646-164559668 CTGAATAAAAACAGTGAAACTGG - Intergenic
1021095803 7:16534846-16534868 CTACATATATACAGTGAGAGAGG + Intronic
1022452129 7:30525385-30525407 CTTAACATAGACATTGACAGTGG - Intronic
1023313720 7:38913732-38913754 CTGAATATATAAAGGGGCACTGG - Intronic
1024534877 7:50421821-50421843 TTGAATATCTCCAATGACAGAGG - Intergenic
1024679929 7:51675109-51675131 CTGAATAGAAATAGTGAGAGTGG - Intergenic
1024967705 7:55038959-55038981 CTGATTGTTTACAGTGGCAGAGG + Intronic
1026596837 7:71739921-71739943 CTGAATATAGACATTCACTGTGG - Intergenic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1028386500 7:90259877-90259899 ATGAATACATAAAGTGAGAGTGG - Intronic
1029352318 7:100022959-100022981 CTTGATATATGAAGTGACAGTGG + Intronic
1029602145 7:101573294-101573316 CTGAATAGAGATAGTGAGAGAGG + Intergenic
1030676487 7:112391108-112391130 GTGAATATATCCAGTGGGAGTGG - Intergenic
1030749694 7:113216229-113216251 CTGAATTTAAATAGTGACATTGG - Intergenic
1030831177 7:114223724-114223746 CTCAACATATACGGTGGCAGAGG - Intronic
1031164035 7:118205665-118205687 GTAAATAAATACAGTGACAATGG + Intergenic
1031651634 7:124298604-124298626 ATAAATATATACAATGAAAGGGG - Intergenic
1031903331 7:127434051-127434073 TTGTATGTATACAGTGACAATGG - Intergenic
1032016325 7:128382574-128382596 CTGAATATGTGCAGGGACATGGG - Intergenic
1032903012 7:136332532-136332554 CTGAAAATATACATTCTCAGAGG - Intergenic
1032968490 7:137131187-137131209 CTGAATATATACAGCTTCTGGGG - Intergenic
1034808995 7:154113927-154113949 CTGAATAGAAGCAGTGACTGTGG - Intronic
1035172582 7:157026744-157026766 TTGAATAGAAGCAGTGACAGTGG + Intergenic
1035702369 8:1646351-1646373 GTGAATACATACAGAGAAAGAGG - Intronic
1036071287 8:5442253-5442275 AAAAATCTATACAGTGACAGAGG - Intergenic
1037169352 8:15873115-15873137 TTGAATATATGTGGTGACAGAGG - Intergenic
1037701157 8:21274867-21274889 CTGAACCAAGACAGTGACAGTGG - Intergenic
1037773010 8:21813904-21813926 CTGAACCTATACAGGAACAGAGG - Intergenic
1038728168 8:30100392-30100414 CTGTATTTCTACAGTTACAGTGG - Intronic
1042952206 8:74212375-74212397 CTGAATTTATATAATGGCAGTGG - Intergenic
1043260900 8:78194458-78194480 CAGAATATCGACAGTGACAATGG + Intergenic
1043275978 8:78393296-78393318 CTGAATATATAAACTTACATTGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046284516 8:112077194-112077216 TTGAATATAAACGGTGAAAGTGG + Intergenic
1046533848 8:115483143-115483165 CTGAATGGATAAAGTGAGAGAGG + Intronic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050588030 9:7133559-7133581 CTCAAAATACACGGTGACAGAGG + Intergenic
1050766637 9:9142673-9142695 CTGAAGCTATACAGTAGCAGAGG + Intronic
1050974873 9:11925086-11925108 CTGAATATAAATGGTGAGAGAGG + Intergenic
1052034505 9:23665080-23665102 CTGAATATATATAGTGACAGGGG - Intergenic
1053738739 9:41118736-41118758 CTGAATATCTAGGGTGAGAGAGG + Intergenic
1054689606 9:68312579-68312601 CTGAATATCTAGGGTGAGAGAGG - Intergenic
1057127209 9:92626992-92627014 ATGAATATATTCAGATACAGAGG + Intronic
1059879646 9:118676157-118676179 CAGAATATATAGATTGAGAGTGG + Intergenic
1060830595 9:126712642-126712664 GTAAATATATTCAGTGACAGTGG - Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1188465070 X:30470451-30470473 GTGGATAAATACAATGACAGAGG - Intergenic
1189306734 X:39992408-39992430 CTAAATACCTTCAGTGACAGAGG - Intergenic
1190266510 X:48830355-48830377 CTGAAGATATCCAGAGGCAGAGG + Intergenic
1190442192 X:50485899-50485921 CTGAACAAAGGCAGTGACAGTGG + Intergenic
1190510250 X:51167064-51167086 CTGAATATATAAAATGAGATTGG - Intergenic
1190716952 X:53112928-53112950 TTGAAAATATACAGTCATAGGGG - Intergenic
1192493824 X:71599735-71599757 ATGACTATGTACAGTGACAAAGG - Intronic
1192873681 X:75207863-75207885 CTGTATATACATTGTGACAGAGG - Intergenic
1194871942 X:99143100-99143122 CTGAATTTATACAGCTACTGTGG - Intergenic
1196345241 X:114648193-114648215 CTGAAAATACAGAGTCACAGAGG - Intronic
1197303123 X:124805587-124805609 CTGGATATCTACAGTGGCCGTGG + Intronic