ID: 1028379891

View in Genome Browser
Species Human (GRCh38)
Location 7:90188351-90188373
Sequence GCTAAGTGAAGGAGTTTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028379889_1028379891 -6 Left 1028379889 7:90188334-90188356 CCATCTCAAATTTTTAAGCTAAG 0: 1
1: 0
2: 1
3: 25
4: 306
Right 1028379891 7:90188351-90188373 GCTAAGTGAAGGAGTTTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028379891 Original CRISPR GCTAAGTGAAGGAGTTTACG AGG Intronic
No off target data available for this crispr