ID: 1028382222

View in Genome Browser
Species Human (GRCh38)
Location 7:90212013-90212035
Sequence CTGCCCGGCGTGGAGGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028382205_1028382222 23 Left 1028382205 7:90211967-90211989 CCCTTGGGGAGTCGGCGCCGCTC 0: 1
1: 0
2: 1
3: 2
4: 29
Right 1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 272
1028382211_1028382222 6 Left 1028382211 7:90211984-90212006 CCGCTCCCGGGGAGCTGCAAGGC 0: 1
1: 0
2: 0
3: 9
4: 188
Right 1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 272
1028382213_1028382222 0 Left 1028382213 7:90211990-90212012 CCGGGGAGCTGCAAGGCTCGCCC 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 272
1028382206_1028382222 22 Left 1028382206 7:90211968-90211990 CCTTGGGGAGTCGGCGCCGCTCC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 272
1028382212_1028382222 1 Left 1028382212 7:90211989-90212011 CCCGGGGAGCTGCAAGGCTCGCC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG 0: 1
1: 0
2: 2
3: 29
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028382222 Original CRISPR CTGCCCGGCGTGGAGGGCGC GGG Exonic
900205019 1:1427944-1427966 CTGCCCTCCGTGGCGGGGGCGGG - Intergenic
900473940 1:2867670-2867692 CTGCCGGGCTTGGAGGGCACTGG - Intergenic
901057468 1:6455364-6455386 CTGCCCCGCGTGGCGGCTGCCGG + Intronic
901793072 1:11664516-11664538 CGGCCAGGGGTGGGGGGCGCGGG + Intronic
902405935 1:16183670-16183692 CTGCCCGGGGTGGGGGGCACTGG - Intergenic
903675539 1:25062410-25062432 CTGCCTGGCCTGGAGGGTGGAGG - Intergenic
903697470 1:25218495-25218517 CTGCCCCCCGTGGAAGGCTCTGG - Intergenic
904652091 1:32013588-32013610 CTTTCTGGCGTGGAGGGGGCGGG - Intergenic
905308455 1:37034292-37034314 CAGCCAGGCGGGGCGGGCGCCGG - Intergenic
905819633 1:40979653-40979675 GGGCCGGGCCTGGAGGGCGCGGG - Exonic
906530728 1:46522510-46522532 CTCCCCGGCCTGGAAGGAGCTGG - Intergenic
907160489 1:52365765-52365787 CTGACGGGCGTGGAGGCGGCGGG + Intronic
915570233 1:156741336-156741358 ATGCTCTGCGTGGAGGCCGCTGG + Intronic
916792589 1:168136955-168136977 CGGCCGGGCGTGGGGGGGGCGGG - Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918288343 1:183080926-183080948 TTGCCCAGGGTGGAGTGCGCTGG + Intronic
919898237 1:202023245-202023267 CTGGCAGGTGTGGAGGGGGCAGG - Intergenic
920154671 1:203938883-203938905 CTGCCCAGGCTGGAGGGCGGTGG + Intergenic
923500422 1:234559635-234559657 CTCCCAGGCTTGGAGGGGGCAGG + Intergenic
923658352 1:235937749-235937771 CTGCCCAGCCTGCTGGGCGCAGG + Intergenic
923674618 1:236069192-236069214 TTGCCCAGCGTGGAGTGCACTGG + Intergenic
924482787 1:244451932-244451954 CGGCCCGGCGGGGCGGGGGCGGG - Exonic
1063080210 10:2760775-2760797 CTGCCAGGCGTGGAGAGTGGGGG - Intergenic
1068544937 10:58334929-58334951 GGGCGCGGCGGGGAGGGCGCAGG + Intergenic
1069090788 10:64196913-64196935 CTGCCCTGCGGGGAGGCAGCTGG + Intergenic
1069664519 10:70145793-70145815 CTGCCCGGCACCGAGGGCGGCGG - Exonic
1070328154 10:75401115-75401137 CTGACCGGCGTGGAAGGCAGGGG + Exonic
1072071680 10:91924028-91924050 CTGCGCGGCGCGTAGGTCGCGGG + Exonic
1072511508 10:96130467-96130489 CTGCCCCGCGGGGAGCGCGGAGG - Intronic
1072757516 10:98030699-98030721 GGGCCCGGGGTGGGGGGCGCCGG + Exonic
1073122711 10:101132120-101132142 CGGCCAGGCGGGGAGCGCGCGGG - Intronic
1076039190 10:127228343-127228365 CTGCCCGGCCCGGAGGTGGCTGG + Intronic
1076787791 10:132759700-132759722 CTGCAGGGTGAGGAGGGCGCCGG - Intronic
1076834385 10:133013815-133013837 GGGCCCGGCGTGGAGGGCATAGG + Intergenic
1076908197 10:133373560-133373582 CGGCGGGGCCTGGAGGGCGCTGG - Exonic
1077021947 11:420873-420895 CTGCGTGGCAGGGAGGGCGCAGG + Intronic
1077049871 11:561744-561766 CTGTCCTGTGGGGAGGGCGCAGG - Exonic
1077377430 11:2211612-2211634 CTGCCTGGTGTGGAGGGGTCGGG - Intergenic
1077385812 11:2269077-2269099 CTCCCCGGCGATGAGCGCGCCGG + Exonic
1077422471 11:2459412-2459434 CTGCAGGGCTTGGAGGGAGCAGG + Intronic
1077504275 11:2922866-2922888 CTGCCAGGCCTGGAGGCCCCGGG + Intronic
1077537036 11:3129370-3129392 CTGCCCGGCGTGGAAAGGGCTGG - Intronic
1078099855 11:8323622-8323644 CTGCCTGGTGTGGAGGGCGGTGG - Intergenic
1081851492 11:46277939-46277961 CGGCCCCGGGTGGGGGGCGCGGG - Exonic
1083920984 11:65781266-65781288 CTGCGCGGCTTGGCGGGCGCTGG - Intergenic
1084028529 11:66467303-66467325 CCGCCCGGGGCGCAGGGCGCGGG + Intronic
1084156790 11:67317676-67317698 CTGCCGGGCGCTGCGGGCGCAGG - Intergenic
1084600895 11:70144906-70144928 CGTCCCTGCGTGGAGGGGGCCGG + Intronic
1084861061 11:72018514-72018536 CTGCCCAGAGTGGAGGGAGGAGG + Intronic
1089244748 11:117110711-117110733 CTGCCCGGGGCGGGAGGCGCCGG + Intergenic
1090064051 11:123488384-123488406 ATGCCCGGCCTGGAGAGCTCCGG - Intergenic
1090238805 11:125167273-125167295 CTGCCAGGGGTGCAGGGGGCTGG - Intronic
1091740711 12:2959098-2959120 CCGCCAGGAGGGGAGGGCGCGGG + Intergenic
1092124949 12:6068507-6068529 TTGCCCGGCGTGGAGTGCAGTGG + Intronic
1092258097 12:6937822-6937844 CTGCCGGGCGTGGAAGCAGCGGG - Intronic
1094393485 12:29978816-29978838 CTGCCCAGGCTGGAGTGCGCTGG + Intergenic
1096634331 12:52948996-52949018 CGGCCCGGGGCGGAGGGCGCGGG + Exonic
1097274983 12:57807040-57807062 CTGACTGGAGTGGAGGGTGCAGG + Intronic
1097292808 12:57933400-57933422 CTGCCCGGGCTGGAGGGCAGTGG + Intergenic
1103702589 12:122855497-122855519 CTGCCCGGCCTGGAGGGCACAGG + Intronic
1103764635 12:123271559-123271581 CTCACCGGCGTTGAGGGCGGCGG + Exonic
1106602669 13:31200593-31200615 CCGCCCGGCGCGGGGCGCGCAGG - Intronic
1107805729 13:44152280-44152302 CTGGCCGGTGTGGAGGGGACTGG - Intronic
1112012119 13:95301316-95301338 TTGCCGGGCGGGGCGGGCGCGGG + Exonic
1113615867 13:111680453-111680475 CTGCCCGCCGTGGACGGGGCAGG - Intergenic
1113621335 13:111765346-111765368 CTGCCCGCCGTGGACGGGGCAGG - Intergenic
1113628255 13:111862422-111862444 CTGCCCAGGCTGGAGGGCGGTGG - Intergenic
1113636382 13:111921654-111921676 CAGCCCGGCCAGGAGGGCGCCGG - Intergenic
1113881624 13:113629984-113630006 CTGCCTGGCGTGGAGCTGGCGGG + Intronic
1114049671 14:18912987-18913009 CTGCCGGGTGTGCAGGGCGTGGG - Intergenic
1114112890 14:19488944-19488966 CTGCCGGGTGTGCAGGGCGTGGG + Intergenic
1114836225 14:26205396-26205418 CGGGCCGGCGGGGAGGGCTCCGG - Intergenic
1115591900 14:34873880-34873902 GGGCCAGGGGTGGAGGGCGCGGG - Intronic
1117131863 14:52695314-52695336 GTGCACGCCGCGGAGGGCGCCGG + Intronic
1117368276 14:55052090-55052112 CTGCGGGGCGGGGCGGGCGCGGG + Intronic
1118348803 14:64959057-64959079 CTGCCCTGCCTGGAGTGAGCTGG - Intronic
1118907580 14:70033722-70033744 CAGCCTGGCGTGGAAGGGGCAGG + Intergenic
1119744322 14:77033461-77033483 CTGCCCAGCCTGGGGCGCGCGGG + Intergenic
1121122220 14:91383227-91383249 CTGCCAGGCCTGGAGTGCCCAGG + Intronic
1121226340 14:92324079-92324101 CTGCCCGGCGGGGAGGGGACTGG - Intronic
1121342925 14:93115817-93115839 CTGCCCGCCGAGAAGGGCGGCGG + Intronic
1122418417 14:101561112-101561134 GTGCGCGGCGAGGGGGGCGCGGG + Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1123028757 14:105440809-105440831 CTCCTTGGCGTGGAGGGCACTGG - Intronic
1123036702 14:105474659-105474681 CTGCCGGGGGTGGCGGGTGCGGG - Intronic
1123980383 15:25596784-25596806 CTGACGGGCGTGGACGGCGAGGG + Intergenic
1124221497 15:27853758-27853780 CTGCCCGGGATGGCGGGCCCAGG - Intronic
1124629248 15:31327566-31327588 CAGCCCGGCGTGGAGCGAGCCGG + Exonic
1125510732 15:40291157-40291179 CTGCCCCGCGAGGAGAGCGCCGG - Exonic
1126113407 15:45188029-45188051 CCGCCGGGCGGGGAGGGGGCGGG + Intronic
1127224894 15:56918617-56918639 CTTCCCGGCGCGGAGGGATCCGG + Exonic
1128564214 15:68689224-68689246 CTGCCTGGGGTGGAGGGTGGAGG - Intronic
1130313055 15:82771540-82771562 CTGCCCAGAGTGGAGGCCGGGGG + Intronic
1130876007 15:88015334-88015356 CCTCCCGGGGTGGAGGGAGCAGG - Intronic
1130908758 15:88257010-88257032 CTGCGAGGCGTGGAGCGGGCGGG - Intergenic
1132643123 16:987086-987108 CCGCCCAGCGTGGAGGGCACTGG - Intergenic
1132828886 16:1918118-1918140 CTGGACGGCTCGGAGGGCGCGGG + Exonic
1132904450 16:2275173-2275195 CTGCCCAGCGTGGAGTGCAGTGG - Intergenic
1133188361 16:4116060-4116082 CTGCCCGCGGCGGCGGGCGCTGG + Exonic
1133286420 16:4692951-4692973 GTGCCCGGCTTGGAGGATGCTGG + Intergenic
1133765194 16:8832885-8832907 CTGCCAGGCCTGGAGGGTGAGGG - Intronic
1134116043 16:11549610-11549632 CAGCCAGACGTGGAGGGAGCCGG - Exonic
1134682294 16:16134674-16134696 TTGCCCAGAGTGGAGTGCGCTGG + Intronic
1135335845 16:21600037-21600059 ACGCCCGGCGGGGAAGGCGCGGG - Intronic
1139701393 16:68710146-68710168 CAGCCCGGCAGGGAGGGAGCAGG - Intronic
1139750554 16:69106790-69106812 CTGGCCGGCCTGGAGGGGCCCGG + Intronic
1141184689 16:81779135-81779157 CTCCATGGCGGGGAGGGCGCGGG + Intronic
1141503271 16:84459320-84459342 CTGCATGGCGTTGAGGGGGCTGG - Exonic
1141622132 16:85241920-85241942 CTGCCGGGAGGGGAGGGAGCTGG + Intergenic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142406360 16:89892371-89892393 CTGCTGGGGGTGGAGGGCGGCGG + Intronic
1142608800 17:1096764-1096786 CTGCCCCGGGTGGAGAGAGCTGG + Intronic
1142608871 17:1096942-1096964 CTGCCCGGGGAGGAGAGAGCCGG + Intronic
1143223709 17:5282558-5282580 CTGCCCGGCGTCGGCGTCGCGGG + Intronic
1144816511 17:18039247-18039269 AGGCGCGGCGTGGAGGGGGCGGG - Intergenic
1145979980 17:29005658-29005680 CCGCCCGGCTTGGCCGGCGCCGG + Intronic
1146126445 17:30235439-30235461 TTGCTGAGCGTGGAGGGCGCAGG + Intronic
1146957226 17:36942726-36942748 CGGAGCGGCGGGGAGGGCGCAGG - Intronic
1148021969 17:44559207-44559229 ATGCGCGGCGTGTAGTGCGCCGG - Exonic
1150429006 17:65100849-65100871 CGGCTGGGCGGGGAGGGCGCGGG - Intergenic
1150433505 17:65137406-65137428 CGGCTGGGCGGGGAGGGCGCGGG - Intergenic
1150642422 17:66958594-66958616 CTGGCCAGAGTGGAGGGCGGAGG - Intergenic
1151096794 17:71507961-71507983 CTGCCTGGGGTCTAGGGCGCAGG - Intergenic
1152178589 17:78803603-78803625 CTGCCCCTCCTGCAGGGCGCTGG + Exonic
1152510888 17:80787025-80787047 GCGCCCTGCGTGGTGGGCGCAGG - Intronic
1152650125 17:81488721-81488743 CTGACAGGCCTGGAGGGCCCGGG - Intergenic
1152655100 17:81515604-81515626 GTGCAGGCCGTGGAGGGCGCAGG - Intronic
1152825002 17:82458968-82458990 CCGCTCGGCGTGGAGGCGGCCGG + Intronic
1153781230 18:8496349-8496371 CTGCCCAGCCTGAAGGACGCAGG - Intergenic
1156253823 18:35376958-35376980 CGGCGCGGCGCGGTGGGCGCGGG - Intronic
1157248078 18:46071432-46071454 CAGCCCAGCCTGGAGGGAGCAGG - Intronic
1157529553 18:48409573-48409595 CCGCGCGGCGGGGAGGGGGCGGG - Intronic
1157590381 18:48833156-48833178 CTGGCTGGAGTGGAGGGCGTGGG + Intronic
1160452447 18:78974522-78974544 CTCGCCGGCGTGGAGGGGCCGGG - Intergenic
1160991864 19:1863391-1863413 CGGCCCGGCCCCGAGGGCGCGGG - Exonic
1161029351 19:2050731-2050753 ATGGCCGGCGTGGGGGGCGCGGG - Intronic
1161984495 19:7646234-7646256 CTGCCCTGCCTGTAGGGCTCGGG + Exonic
1163132793 19:15286200-15286222 CTGCTCGGGGTGGAGGGGACTGG - Intronic
1163311713 19:16518967-16518989 CTCCATGGCGTGGAGGGCACGGG - Exonic
1163490785 19:17616262-17616284 CTGAGCGGCTTGGAGGGCCCAGG - Intronic
1163591111 19:18194652-18194674 CTGCCCGGGGTGGGCGGCGTGGG + Intronic
1163676069 19:18655934-18655956 CAGCCCGGCCTTGAGGGCACTGG + Intronic
1163714965 19:18868248-18868270 CTGCAGGGGGTGGAGGGTGCTGG + Intergenic
1163756820 19:19111295-19111317 CTGCCCGGCCTCCAGGGTGCGGG + Exonic
1164591739 19:29511212-29511234 CTGCCTGGCGTGGAGGGGAAGGG + Intergenic
1165119632 19:33550915-33550937 CTGCCCGGGCTGGAGGGCAGTGG - Intergenic
1165151994 19:33766412-33766434 CTGCCCCGAGTGCAGGGTGCTGG - Intronic
1165213754 19:34254785-34254807 CCGCCCGCTGTGGAGGACGCCGG + Intronic
1165347719 19:35259221-35259243 CTGCCTGGGGTGCAGGGCACAGG - Intronic
1166727418 19:45037467-45037489 CTGCCCGGCCTGGAGCCCCCTGG + Exonic
1167637955 19:50666426-50666448 CTGCCCTGGGAGGAGGGCCCGGG - Exonic
1168139428 19:54375339-54375361 CTGCACAGCGGGGCGGGCGCAGG - Intergenic
1168154437 19:54465066-54465088 GTGCCGGGCGGGAAGGGCGCGGG + Exonic
1168158558 19:54492758-54492780 CTGCACAGCGAGGCGGGCGCAGG + Intergenic
1168728611 19:58606730-58606752 CCGCCCGGCGGGGAGCGCGGAGG - Intergenic
925427917 2:3766123-3766145 GTGCCCGGGGTGGTGGGGGCTGG + Intronic
927567238 2:24123687-24123709 CGGCCTGGCGGGGAGGTCGCCGG - Intronic
928143605 2:28751956-28751978 CTACCCGGCGGGGAGGGGGTGGG + Exonic
928294113 2:30067714-30067736 CTGCCCAGCCTGGAGTGCGGTGG - Intergenic
929242270 2:39665662-39665684 GTGCGCGGGGTGGGGGGCGCCGG + Intronic
930688117 2:54330741-54330763 CTGCGCGGCGAGGAGGGCGGGGG - Intronic
936057517 2:109272078-109272100 CTGCCCTGAGTGGTGGGGGCAGG - Intronic
939612948 2:144332342-144332364 CGGCCCCGCGAGGCGGGCGCCGG + Intronic
942219653 2:173756736-173756758 CTGCCCAGATTGGAGGGCGGTGG - Intergenic
943470863 2:188292286-188292308 GTGCCCGGGAAGGAGGGCGCGGG + Intronic
944174145 2:196811158-196811180 ATGCCAGGCGTAGAGGGAGCAGG + Intergenic
944524022 2:200599822-200599844 TTGCCCGGGCTGGAGGGCGGCGG + Intronic
944811251 2:203328902-203328924 CTGACCGGCGCGGAGTGCGGGGG - Intronic
946177025 2:217928350-217928372 CTGCCTGGTGGGGAGGGCACAGG - Intronic
946416734 2:219543655-219543677 CTGCTCTGCGGGGAGGGAGCGGG - Exonic
946483814 2:220081567-220081589 CTGCACCGAGTGGAGGGAGCTGG + Intergenic
947035750 2:225852599-225852621 CTGCCCAGGCTGGAGGGCGGTGG + Intergenic
947399074 2:229714422-229714444 ATGGCCGGCCGGGAGGGCGCGGG + Exonic
948696693 2:239736442-239736464 CAGCCCGGGGTGGAGAGAGCAGG - Intergenic
1171178568 20:23074437-23074459 CTGCCCTGGGTGGAGGTGGCGGG - Intergenic
1172146701 20:32762606-32762628 CTGGCGGCCGTGCAGGGCGCTGG - Exonic
1173930222 20:46811598-46811620 CTGCGCGGCGCAGATGGCGCCGG + Intergenic
1174054005 20:47785694-47785716 CTCCCCTGCGTGGAGGCCGGCGG - Intronic
1174449047 20:50608798-50608820 CTGCCTGGCAGGGAGGGCCCTGG - Intronic
1174553174 20:51375893-51375915 CTGCCCTGCGTTCAGGGAGCTGG - Intergenic
1178610070 21:34072945-34072967 CTACCCGGCGAGGAGCGCGCTGG - Intergenic
1178981201 21:37267027-37267049 CTGCCCTGCGAGGAGGCCCCAGG - Intronic
1179393148 21:41012151-41012173 CTCCCCGGGCTGGAGGGCTCCGG - Intergenic
1179511933 21:41879141-41879163 CTGCCGGGCGCGGGGGGCGGGGG + Intronic
1179718631 21:43302951-43302973 CGGCCCGGCCTGGAGAGCTCAGG + Intergenic
1180010986 21:45051290-45051312 ATGCCCGGGGTGGGGGACGCTGG - Intergenic
1180046746 21:45309901-45309923 CTGCCCGCCCTGGAGAGCCCGGG + Intergenic
1180230023 21:46421588-46421610 GTGGCTGGCGTGGAGGGTGCAGG + Intronic
1180468150 22:15635362-15635384 CTGCCGGGTGTGCAGGGCGTGGG - Intergenic
1181041305 22:20193949-20193971 CTGCCCGGCCTGCAGGGCTGTGG - Intergenic
1181140995 22:20804765-20804787 CTGTCCTGCATGGAGGGCACTGG - Intronic
1181537510 22:23554228-23554250 CTGCCCAGCATGGGGGGAGCAGG - Intergenic
1183357118 22:37365495-37365517 CTGCCCGGGCTGGAGAGGGCCGG + Intergenic
1183447438 22:37867615-37867637 CTGCCCAGGGTGGAGTGCGGTGG - Intronic
1183640709 22:39090778-39090800 CTGCCCGGGGTGGTGAGGGCCGG - Intergenic
1183662480 22:39229833-39229855 CTGCCCGGCGGGGGTGGCACAGG + Intronic
1183959698 22:41404049-41404071 CTGCCTGGCACGGAGGGCCCTGG - Intergenic
1184017915 22:41800020-41800042 CTGCCGGGCGGGAAGGGAGCTGG - Intergenic
1184616393 22:45641070-45641092 CTCCCTGGAGAGGAGGGCGCGGG - Intergenic
1184668470 22:46000817-46000839 CTGCCCAGGGTGGAAGGGGCAGG - Intergenic
1185313909 22:50170651-50170673 GGGCCCGGCGAGGGGGGCGCGGG - Intergenic
1185384765 22:50526611-50526633 CTGCTCTGCATGGACGGCGCAGG - Exonic
950416369 3:12871102-12871124 CTGCCCAGCTTGGAGGAAGCTGG - Intronic
950683919 3:14603028-14603050 CTGCCCGGCGGGGGCGGGGCCGG - Intergenic
951140111 3:19148434-19148456 CTGGCGGGGGTGGAGGGGGCGGG + Exonic
954912434 3:54121531-54121553 CTGCCCAGTGCGGTGGGCGCCGG + Intergenic
955060141 3:55486805-55486827 GCGCCCGGCGTGGAGGGCGAAGG + Intronic
955322965 3:57987574-57987596 CTGCCCAGCTTGGAGGGCAACGG + Intergenic
961714297 3:128848153-128848175 CTGCCCAGCTTGGAGGACGCTGG + Intergenic
961735822 3:129001653-129001675 GAGGCCGGCATGGAGGGCGCGGG + Exonic
962134740 3:132722156-132722178 CTGCCCCGCGGGGTGGGCGCGGG - Exonic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
963040493 3:141066385-141066407 CTGCCAGGCGTGCAGGCCGCGGG - Exonic
966911668 3:184563151-184563173 CAGCCCGGCGTTGTTGGCGCTGG + Intronic
968434024 4:575895-575917 CAGCCCGGAGTAGAAGGCGCCGG + Intergenic
968512677 4:1002514-1002536 CTCCCCAGCCTGGAGGGCCCTGG - Intronic
968582731 4:1402527-1402549 CTGCCCGTCGTCGTGGGCGCAGG - Intergenic
968908557 4:3465394-3465416 GGGCCCGGCGTGGAGGGAGCAGG + Intronic
968966551 4:3771801-3771823 TTGCCCTGTGTGGAGGGTGCTGG + Intergenic
969057098 4:4408859-4408881 CTGCCCCGGCTGGAGGGCACGGG - Intronic
969362698 4:6674615-6674637 GTGTCCCGCGTGGAAGGCGCTGG + Intergenic
969845847 4:9919500-9919522 CTGCCCGCCTTGGGGGGTGCTGG + Intronic
970191350 4:13522524-13522546 CTGCCAGGCTTGGCGGGCGGGGG - Intergenic
970869254 4:20796346-20796368 TTGCCCGGGCTGGAGTGCGCTGG + Intronic
981128558 4:141133179-141133201 CCGCCGGGGCTGGAGGGCGCAGG - Intronic
982000690 4:151018510-151018532 CTGCCCGGGCTGGAGGGCAAAGG - Intergenic
985575463 5:671611-671633 CTGCCCGGCCTGCAGGGTACAGG + Intronic
985879198 5:2625643-2625665 CTTCCAGGTGTGGAGGGAGCAGG - Intergenic
986315437 5:6583471-6583493 CTGCACGCCTAGGAGGGCGCAGG + Intergenic
988609567 5:32712014-32712036 CTGCGCAGCGTGGAGGGCAACGG + Exonic
989229936 5:39074274-39074296 GTGCCAGGGGTGGCGGGCGCCGG + Intronic
996070562 5:119126241-119126263 CTGCCCAGGGTGGAGGGCAATGG - Intronic
996530417 5:124521853-124521875 CTGCCCGCCGGGCAGGGCTCGGG + Intergenic
997378867 5:133421101-133421123 CTGCCAGGGGTGGAGGGCAATGG - Intronic
999253272 5:150195168-150195190 CTGCCCACCGTGCAGGGCGTGGG - Intronic
1001639750 5:173236074-173236096 CTGCCAGGCAGGGAGGGCACGGG - Intergenic
1003118696 6:3301678-3301700 CTGCCCAGGGCTGAGGGCGCAGG + Intronic
1004123157 6:12845439-12845461 CTGCCCAGCACGGAGGGCGGGGG - Intronic
1006405696 6:33843569-33843591 CTGCCCGGCGTGGGAGGCTTGGG - Intergenic
1006444895 6:34074598-34074620 CTGCCAGGAGAGGAGGCCGCTGG + Intronic
1007390480 6:41547248-41547270 AGGCCCGGCGGGGAGGGGGCGGG - Intronic
1012602710 6:101117526-101117548 CTGCCCAGGGTGGAGGCCGAGGG - Intergenic
1013963452 6:115928296-115928318 CTGCCCGGGGTGGGCGGGGCCGG + Intergenic
1016235418 6:141857918-141857940 CTGCCCAGGATGGAGGGCGGTGG + Intergenic
1017001034 6:149997716-149997738 CTGCCGAGCGTGGAGTGGGCTGG + Intergenic
1017662384 6:156687314-156687336 CCGCCCGGCGCGGGGCGCGCGGG + Intergenic
1018400258 6:163414423-163414445 CTCCCCGGCGGGGCGGGCGACGG - Intronic
1019054507 6:169213602-169213624 CTGCACGGGGTGGGGGGCACGGG + Intergenic
1019301428 7:306017-306039 AGGCCCGGGCTGGAGGGCGCAGG - Intergenic
1019347442 7:537993-538015 CGGCCAGGCGTGGAGGGAGGGGG - Intergenic
1019471729 7:1224756-1224778 CTGCACGGAGTGGAGGGGTCAGG - Intergenic
1020022685 7:4878498-4878520 CTGCCCGGGCTGGAGGGCCGTGG - Intronic
1020125411 7:5530382-5530404 CGGACCGCCGTGGGGGGCGCGGG - Intronic
1020125541 7:5530870-5530892 CTGCCCAGCGTGGGGCGCGGGGG - Intronic
1021876577 7:25054970-25054992 CTGCCCAGCGTGGAGCCTGCGGG - Intergenic
1024076404 7:45820691-45820713 TTGCCCGGGGTGGAGTGCACCGG - Intergenic
1024965434 7:55019331-55019353 CTGCCCGGCGAGTCGGGCTCTGG + Exonic
1026968520 7:74454523-74454545 CTGCCCGCGGTGGCGGGCGCCGG + Intronic
1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG + Exonic
1029443603 7:100601175-100601197 GTGCCCGGCTTGGTGGGTGCAGG + Intergenic
1030347960 7:108455288-108455310 CCGCGCGGCGTGGAGGGGGCCGG + Intronic
1030819288 7:114076972-114076994 CTTCCCGGCGGGCAGGGCTCGGG - Intergenic
1030820557 7:114086666-114086688 CGGCCCAGCGTGGAGGTGGCTGG - Intronic
1031909230 7:127496923-127496945 CTGCCCGGGCTGGAGAGCGATGG - Intergenic
1032080771 7:128857377-128857399 CAGCCCAGCCTGGAGGGCTCCGG + Intronic
1032091482 7:128913783-128913805 CAGCCCAGCCTGGAGGGCTCCGG - Intergenic
1033406368 7:141074004-141074026 CTGCGGGGCGGGGAGGGGGCGGG + Intergenic
1034522687 7:151632495-151632517 CGGCACGGCGGGGAGGACGCGGG - Intronic
1034546182 7:151790958-151790980 CTGCCCGGAGTGGTGGAGGCAGG + Intronic
1038828457 8:31032880-31032902 GGGCCCGGCGTGGGGGTCGCGGG - Exonic
1038959030 8:32498385-32498407 CTGCAGGGCGTGGAGGCCTCAGG + Intronic
1039592084 8:38757458-38757480 CAGCCCGGGATGGAGCGCGCTGG + Intronic
1045111563 8:98942124-98942146 CCGGCCGGCGTCTAGGGCGCAGG - Intronic
1045206223 8:100043734-100043756 CTGCCCGGCCTGGAGTGCAGTGG - Intronic
1048009261 8:130443290-130443312 CTTCTCCGCGGGGAGGGCGCCGG - Intronic
1048152094 8:131904103-131904125 CCGCCCGGCGAGGAGTGGGCTGG + Exonic
1049411427 8:142475560-142475582 GCGCCGGGCGTGGAGGGCGGCGG + Exonic
1049838521 8:144755344-144755366 CAGGCAGGCGGGGAGGGCGCGGG - Intronic
1051641859 9:19230897-19230919 CTGCAAGGCTGGGAGGGCGCGGG + Intronic
1053009368 9:34624637-34624659 CTGGCCGGCGGGGGCGGCGCGGG - Intronic
1055665033 9:78544793-78544815 TTGCCCAGCCTGGAGGGCGGTGG - Intergenic
1056558213 9:87707135-87707157 CAGCAGGGCGTGGAGGGGGCTGG - Exonic
1056965485 9:91160609-91160631 CTGCACGGGGTGGAGGGGGCGGG + Intergenic
1058991099 9:110256029-110256051 CTGCCCGGACGGGAGGGTGCAGG + Intronic
1060846211 9:126839505-126839527 CTCCCCGGGGTGGAGGCCGGTGG + Intergenic
1061244479 9:129394361-129394383 CTGCCCAGCATGGGGGGAGCAGG + Intergenic
1061248811 9:129414773-129414795 CTGCCGGGCGAGGCGGGAGCCGG + Intergenic
1062362023 9:136192859-136192881 CAGCCCGGGGTGCAGGGAGCCGG - Intergenic
1062535421 9:137019101-137019123 CTGCCCGGCTCGGCAGGCGCAGG - Intronic
1062582948 9:137236446-137236468 CTCCCCGGCTGGGAGGGCTCTGG + Exonic
1062587363 9:137255366-137255388 CTGGCCGAGCTGGAGGGCGCCGG + Exonic
1185486801 X:487746-487768 CTGCCCAGGCTGGAGGGCGGTGG - Intergenic
1185517501 X:711295-711317 TTGCCCAGGGTGGAGGGCACTGG + Intergenic
1185779155 X:2829917-2829939 GTGCGGGGCGTGGAGGTCGCAGG + Intronic
1189484722 X:41421291-41421313 CTGCCCTGCTTGGAGGTTGCAGG - Intergenic
1191001117 X:55660494-55660516 CTGCCCAGGGTCGAGGGAGCAGG + Intergenic
1195269412 X:103215394-103215416 GTGCCCGGCCCGGAGGGAGCCGG + Intronic
1195923194 X:110002707-110002729 GCGCCCGGCGCGGAGAGCGCGGG + Intronic
1196882012 X:120207118-120207140 ATGCCCAGCTTGGAGGGCACTGG + Intergenic
1200827075 Y:7657284-7657306 CTGCCCGGCCTGGAGGGCACAGG + Intergenic
1200958496 Y:8973761-8973783 CTGCCCGGGCTGGACGGCACAGG - Intergenic
1202232797 Y:22672501-22672523 CTGCCTGGCCTGGAGGGCACAGG - Intergenic
1202310359 Y:23523657-23523679 CTGCCTGGCCTGGAGGGCACAGG + Intergenic
1202560443 Y:26146937-26146959 CTGCCTGGCCTGGAGGGCACAGG - Intergenic