ID: 1028386707

View in Genome Browser
Species Human (GRCh38)
Location 7:90262578-90262600
Sequence GTTGGTTCTCTAACAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028386707 Original CRISPR GTTGGTTCTCTAACAAGTTC TGG Intronic
903902051 1:26654268-26654290 GTTGGTCCACCTACAAGTTCAGG + Intergenic
908433716 1:64083951-64083973 GTTGGATCTCTGTCAAGTACTGG + Intronic
909723769 1:78809660-78809682 GTTGTATCTCTGACAAGTTTTGG + Intergenic
911537196 1:99114630-99114652 GTTGGGTCTCTGACAGGTTTTGG + Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
912707162 1:111923446-111923468 TCTGGTTCTCCAACAAGCTCAGG + Intronic
914354783 1:146875213-146875235 GTTGGTGCTTTAACAAGTACAGG - Intergenic
914801812 1:150967770-150967792 GTAGGTTCTCTGGCAAGGTCAGG - Intronic
916092473 1:161318374-161318396 GTATGTTCTCTAAACAGTTCAGG + Intronic
917798507 1:178549623-178549645 GTAAATTCTCTAATAAGTTCAGG + Intergenic
1065124293 10:22559282-22559304 GTTGGTTCTAGAAAAAGTTGGGG - Intronic
1065807872 10:29411506-29411528 GTTGGTTCTCATGTAAGTTCAGG + Intergenic
1067190968 10:44067936-44067958 GTTGATACTCTATCAAGTTGCGG + Intergenic
1068266420 10:54656233-54656255 GTGGGTTCTCTGACAGGTCCTGG - Intronic
1068409682 10:56638883-56638905 GTTGTATCTCTAACAGGTTTTGG + Intergenic
1068455764 10:57251615-57251637 GTAGGTTCTCAAACACTTTCTGG - Intergenic
1068633997 10:59328119-59328141 GTTGGTTCTCTGCCAAATGCAGG + Intronic
1072923757 10:99598176-99598198 GTTGATTCTCAAAACAGTTCTGG - Intergenic
1075232539 10:120693258-120693280 GTTGGTTTTCTTATAAATTCAGG - Intergenic
1077573431 11:3357771-3357793 CTTGGGTCTCTAGCAGGTTCTGG + Intronic
1077828513 11:5837053-5837075 GTTGTGTCTCTGCCAAGTTCCGG + Intronic
1079519231 11:21305089-21305111 TTTGGTCCACTAACAAGTCCTGG - Intronic
1079945726 11:26738447-26738469 GTTGGTTCTCTCTCATGGTCTGG - Intergenic
1085876577 11:80414319-80414341 GTTGTTTCTCTTTCATGTTCGGG - Intergenic
1086056890 11:82657389-82657411 CTTGGTTCTATAAAAACTTCAGG - Intergenic
1087982899 11:104638833-104638855 ATTTGTTCTCTATCAAGTTTGGG + Intergenic
1093124250 12:15308779-15308801 GTTGGTTGTTTAAAAAATTCTGG + Intronic
1097092805 12:56520895-56520917 GTTATTTCTCTAACAATTGCAGG - Intergenic
1098451080 12:70618615-70618637 GTTGCATGTCTAATAAGTTCTGG + Intronic
1100105810 12:91170486-91170508 GGTGCTTGTCTACCAAGTTCAGG + Intronic
1100934248 12:99645265-99645287 GTTGGTTCTTTTAAAAGTTTTGG + Intronic
1106527825 13:30558785-30558807 TTTGCATTTCTAACAAGTTCAGG - Intronic
1115179379 14:30604555-30604577 TTTGCATTTCTAACAAGTTCTGG + Intronic
1115252625 14:31365306-31365328 CCTGGTTCTCTAAGAAATTCTGG + Intronic
1115492372 14:33969923-33969945 TGTGGTTCTATATCAAGTTCAGG - Intronic
1118386444 14:65259259-65259281 GTTGGTCCTATAACAAGGTTAGG + Intergenic
1120564285 14:86035932-86035954 ATTGGTTCTATAAGAAGCTCTGG + Intergenic
1120803555 14:88720308-88720330 GTTGGTTCTCTGCCAGGTTTTGG - Intronic
1123684729 15:22788655-22788677 GTTAGTTTTCTAAAAAGTTGAGG + Intronic
1125216315 15:37279648-37279670 GTTGTATCTCTAACAGGTTTTGG + Intergenic
1131935291 15:97497568-97497590 GATAATCCTCTAACAAGTTCAGG - Intergenic
1133744873 16:8678540-8678562 GTTGTTTCTCAAACAATTTCTGG - Intronic
1139979237 16:70840319-70840341 GTTGGTGCTTTAACAAATACAGG + Intronic
1142976387 17:3647148-3647170 CATGGTTCTCTAACAATCTCTGG + Intronic
1150075275 17:62186826-62186848 TTGGGTTCTCTATCATGTTCAGG - Intergenic
1150093250 17:62349487-62349509 TCTGGATCTCTAGCAAGTTCAGG + Intergenic
1150168091 17:62964260-62964282 GTTGGTTTTCAAACTAGTTCAGG - Intergenic
1154182710 18:12150407-12150429 TTTGATTCTCTAGCAAGTTTGGG - Intergenic
1156529598 18:37802371-37802393 GTTGTGTCTCTGACAAGTTTTGG + Intergenic
1157604297 18:48916021-48916043 GTTTTTTCTAAAACAAGTTCTGG - Intergenic
1159719636 18:71872125-71872147 GTTGGCTCTCTACCAATTCCTGG + Intergenic
1159721849 18:71900033-71900055 GTTGCTTCTGTAATAACTTCAGG + Intergenic
1164393730 19:27846386-27846408 CTTGGGTCTCTAGCAGGTTCTGG + Intergenic
1165185465 19:34016870-34016892 GATGGTTCTCAGACAAGATCAGG + Intergenic
1165232116 19:34393784-34393806 GCTGGTTCTCTGCCAAGTGCTGG + Intronic
941238981 2:163013563-163013585 GTTGTGTCTCTAACAGGTTTTGG + Intergenic
942407609 2:175672312-175672334 GTTGGGTCTCTGACAGGTTTTGG - Intergenic
947285565 2:228510822-228510844 GTTTGTTTTCTAACAAGTCATGG + Intergenic
1169158032 20:3350621-3350643 GTCAGTTCTCTAAAATGTTCTGG - Intronic
1169291012 20:4352898-4352920 TTTGGTTCTTTAAAAATTTCTGG + Intergenic
1169854984 20:10092631-10092653 TTTGCATTTCTAACAAGTTCTGG + Intergenic
1175234567 20:57501231-57501253 TTTGGTTCTTTAATAAGTGCCGG - Intronic
1177541331 21:22497152-22497174 GTTGGGTCTCTTACAGGTTTTGG - Intergenic
1180790531 22:18573326-18573348 GTGGGTTCTCTGACAAGTGTGGG - Intergenic
1181231207 22:21421989-21422011 GTGGGTTCTCTGACAAGTGTGGG + Intronic
1181247444 22:21512879-21512901 GTGGGTTCTCTGACAAGTGTGGG - Intergenic
954769737 3:52955875-52955897 GTTGTTTCTCTGACAGGTTTTGG - Intronic
959341412 3:105136154-105136176 CTTGGTACTCTTATAAGTTCTGG + Intergenic
960132123 3:114068381-114068403 GTTGGATTTTTAACAACTTCAGG + Intronic
964029605 3:152121695-152121717 TTTGGTTCTATAACCAGTTTCGG - Intergenic
964059908 3:152508872-152508894 GGTGGTTCTCTAACATCTTGTGG + Intergenic
965472480 3:169111901-169111923 GATGGTTCTCTAATAAAATCAGG - Intronic
966064626 3:175803920-175803942 GTTGATTTTCTAAGAATTTCAGG + Exonic
969189125 4:5502799-5502821 GTGAGTTCTCTCACAAGATCTGG - Intergenic
971559805 4:28063497-28063519 GATGTTTCTCTCACAATTTCAGG - Intergenic
974583736 4:63841405-63841427 GTAAGTTCTCTAAAAAGCTCTGG - Intergenic
976130135 4:81875302-81875324 GCTGATTCTCTAGCAATTTCTGG + Intronic
976438626 4:85047219-85047241 GTTGGGTCTCTGACAGGTTTTGG - Intergenic
977613689 4:99063702-99063724 GTTTGTTCTCTAACGACTTCTGG + Intergenic
979478627 4:121187819-121187841 ATAGGGTCTCTAACAAGTTCTGG + Intronic
980467683 4:133206132-133206154 CTTGGTTATCTAACAAGACCAGG - Intronic
980865166 4:138545861-138545883 GTTGTTTCTCTGCCAGGTTCTGG - Intergenic
981778557 4:148398297-148398319 ATTAATTCTCTAACAAGTTCAGG + Intronic
984324703 4:178237090-178237112 GTTGTTTCTCTGACAGGTTTTGG + Intergenic
984499457 4:180540505-180540527 TTTGTTTCTCTAACAAGTCATGG + Intergenic
986387473 5:7248675-7248697 GATGGTTCTCTAAGGAGTTTTGG + Intergenic
987106986 5:14649066-14649088 CTTGGTGCTCTGACCAGTTCAGG + Intergenic
988562097 5:32290641-32290663 GATGGCTCTGTAACAAGTCCAGG + Intronic
988762888 5:34333283-34333305 CTTGGTTCTCTGACCATTTCAGG + Intergenic
990334422 5:54757959-54757981 GTTTCCTCTCTAACCAGTTCTGG - Intergenic
995629357 5:114116756-114116778 TTTGATTCTCTAGCAAGTTGTGG + Intergenic
995921276 5:117316860-117316882 GTTTGTTTTCTTACAATTTCAGG + Intergenic
996592610 5:125164360-125164382 GTTGTGTCTCTAACAGGTTTTGG - Intergenic
998019951 5:138760934-138760956 GTTGGATATATAATAAGTTCTGG + Intronic
998574840 5:143303604-143303626 GTTGTTTCTCTACCAGGTTTTGG - Intronic
1001102004 5:168822087-168822109 CTTGCTTTTCTAACAAGTTCTGG + Intronic
1002169173 5:177365947-177365969 GTTGGGTCTCTTATAGGTTCTGG + Exonic
1002175918 5:177401156-177401178 GTTGGTTCCCTTACAAGTGAAGG - Intergenic
1007862308 6:44924167-44924189 GTTGTTTCACTAACAATATCTGG - Intronic
1010112020 6:72248062-72248084 GTTATTTCTCCAACAAGTCCTGG + Exonic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1015926459 6:138314499-138314521 GTTGGTGCTGAAACAAGTTAAGG - Intronic
1017443258 6:154484278-154484300 GTTGGTTATATAACAAGAGCAGG - Intronic
1018040167 6:159914944-159914966 ATTGTTTCTCTTACCAGTTCTGG + Exonic
1018337450 6:162809224-162809246 CTTGCTTCTGTTACAAGTTCCGG + Intronic
1020762364 7:12284110-12284132 CTTGATTCTCTAACAACTTGTGG - Intergenic
1025771095 7:64508072-64508094 CTTGTTTCTCTAACAAGTGAAGG - Intergenic
1025875359 7:65476334-65476356 CTTGGGTCTCTAGCAGGTTCTGG - Intergenic
1028386707 7:90262578-90262600 GTTGGTTCTCTAACAAGTTCTGG + Intronic
1028662105 7:93290174-93290196 ATTGGTTCTCTAGGAATTTCTGG + Intronic
1028931015 7:96413094-96413116 GTTTGATCTCTAAAAAGTTAAGG + Intergenic
1029342325 7:99955320-99955342 GAGGGTTCTCAAACAAGCTCTGG - Intergenic
1032249614 7:130243668-130243690 GTTGTTTCTCTGCCAAGTTTTGG + Intergenic
1045919863 8:107517315-107517337 GTCTGTTCTCTAACAATTTCCGG - Intergenic
1046796312 8:118376598-118376620 GATGATTATCTAACATGTTCAGG - Intronic
1050694787 9:8266651-8266673 GTAGGTTCTTTATCAAGCTCAGG - Intergenic
1056541589 9:87576033-87576055 GCTTTTTCTCTAACAAGCTCAGG + Intronic
1057093614 9:92283685-92283707 GTTGGTTATATAACAAGTAGTGG - Intronic
1057560445 9:96124193-96124215 TTTGGTTCTGTGACAAGTGCGGG + Intergenic
1058510893 9:105714789-105714811 CTTGTTTCTCTAAGACGTTCTGG + Intronic
1059798856 9:117729412-117729434 GTTCATTTTCTAACAAGATCAGG - Intergenic
1188251596 X:27902515-27902537 GTTGATTCTCTCACATCTTCAGG - Intergenic
1190758469 X:53421185-53421207 AGTGGTTCTCAAACAAGTTGGGG + Intronic
1199401805 X:147407054-147407076 GTTGTTTCTCTGACAGGTTTTGG - Intergenic
1201573266 Y:15435998-15436020 GTTGGTTCTCTGGCAAGGTTAGG - Intergenic