ID: 1028393486

View in Genome Browser
Species Human (GRCh38)
Location 7:90341309-90341331
Sequence AGACCTCGGTGGTGATCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028393479_1028393486 18 Left 1028393479 7:90341268-90341290 CCTCTCCTTTGTTCATCAGAAAC 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1028393486 7:90341309-90341331 AGACCTCGGTGGTGATCGGGAGG No data
1028393481_1028393486 -4 Left 1028393481 7:90341290-90341312 CCTTATTAAGATTTTTCTTAGAC 0: 1
1: 0
2: 3
3: 20
4: 295
Right 1028393486 7:90341309-90341331 AGACCTCGGTGGTGATCGGGAGG No data
1028393480_1028393486 13 Left 1028393480 7:90341273-90341295 CCTTTGTTCATCAGAAACCTTAT 0: 1
1: 0
2: 3
3: 52
4: 236
Right 1028393486 7:90341309-90341331 AGACCTCGGTGGTGATCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028393486 Original CRISPR AGACCTCGGTGGTGATCGGG AGG Intronic
No off target data available for this crispr