ID: 1028396104

View in Genome Browser
Species Human (GRCh38)
Location 7:90369994-90370016
Sequence TTGGAGACTCAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1128
Summary {0: 1, 1: 7, 2: 69, 3: 188, 4: 863}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028396097_1028396104 28 Left 1028396097 7:90369943-90369965 CCATCTTGGAACTTAACTCTTAC 0: 1
1: 0
2: 1
3: 6
4: 172
Right 1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG 0: 1
1: 7
2: 69
3: 188
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028396104 Original CRISPR TTGGAGACTCAGAGGGAGGA AGG Intronic
900517841 1:3091566-3091588 TGGGAGAGTCTGAGGGAGGCTGG + Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901318036 1:8322112-8322134 TTGGTGACTGAGTGGGTGGATGG + Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902375460 1:16028198-16028220 TTAGGGGCTCAGTGGGAGGATGG - Intronic
902598666 1:17526187-17526209 TTGCAGCCACACAGGGAGGAAGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
903886793 1:26545645-26545667 TTGTAGGCCCACAGGGAGGATGG + Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
903963767 1:27073287-27073309 TTGGAAGTGCAGAGGGAGGATGG - Intergenic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904574795 1:31498421-31498443 TGGGAGACTGAGCAGGAGGATGG - Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904778020 1:32923868-32923890 TTTGTGCCTCAGCGGGAGGAGGG + Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906659648 1:47573330-47573352 TCTGAGACTCTGAGGGAGGGAGG - Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907994892 1:59620074-59620096 TTATGGAGTCAGAGGGAGGAAGG + Intronic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909990969 1:82222269-82222291 GGGGAGACTCAGAGAGAGAAGGG - Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912755325 1:112320266-112320288 TGGGAGTCTCTGAGGCAGGAGGG + Intergenic
912939985 1:114036336-114036358 TTGGAGATTTGGAGGAAGGAGGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
914335627 1:146712589-146712611 GTGTAGAGTCAGAGGAAGGAAGG + Intergenic
914430137 1:147613216-147613238 TTTGAGACTCAGAGGGAAGTAGG + Intronic
914802353 1:150970961-150970983 TTGGATACCCAGAGGAGGGAGGG + Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915018005 1:152754539-152754561 TTGGGGACTCAGGGGAAAGATGG - Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916716073 1:167447812-167447834 TTGGGGACTCAAAGGAAGGAAGG - Intronic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917510861 1:175668259-175668281 TGAGAGACACAGGGGGAGGAAGG + Intronic
917816760 1:178718613-178718635 TAGGAAACTCAGAGTCAGGAAGG + Intergenic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919131239 1:193453173-193453195 CTAGAGACTCAGAGGGAGTCAGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919394548 1:197028529-197028551 TTTGGGAGTCCGAGGGAGGAGGG - Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919773668 1:201179305-201179327 TGGGAGAGTCACATGGAGGATGG - Intergenic
920245726 1:204585941-204585963 TTGGGGGTTCAGAGGGAGGGCGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921728779 1:218553527-218553549 CAGGAGACTCAAAGGGAAGAGGG - Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923067409 1:230531513-230531535 TTGGAGACTCAAAGGAAGGGTGG + Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923822014 1:237455225-237455247 TTGGAGACTACGAGGGTTGATGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
923909052 1:238418975-238418997 TTGTAAAGTCAGAGGCAGGAAGG - Intergenic
924010904 1:239664577-239664599 TATGAGACTAAGAGGAAGGAAGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924443307 1:244104568-244104590 TGGGTGACTCAGAGCGTGGAGGG - Intergenic
924497441 1:244603761-244603783 TTTGGGAATCAGAGGCAGGAGGG + Intronic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
924716857 1:246583352-246583374 TTTGAGAGTCAGAGGAATGAAGG - Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1065943093 10:30582699-30582721 TTGGAGACTTAGAGGAAGGGGGG + Intergenic
1066233908 10:33467193-33467215 TTTTAGAGTCAGAGGGAGGAGGG + Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067146830 10:43700407-43700429 TTGGGGGCTCTGAGGGAGGGAGG - Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068155227 10:53188769-53188791 TTACAGACTCATAGGCAGGAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068946091 10:62730238-62730260 TGGGACAGCCAGAGGGAGGATGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069416811 10:68207860-68207882 GTGGAAACTCACAGGGAGGGTGG - Intronic
1069717499 10:70530318-70530340 TGGGAGCCTCAGAGGAAGCAGGG + Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1072035686 10:91561148-91561170 TTGCAGACTCATAGGCAGAAGGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072349506 10:94543604-94543626 TGGGAGGCTGAGTGGGAGGATGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1076276874 10:129207653-129207675 TTGGGGGCTCAGAGCGTGGAGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076643518 10:131935336-131935358 TAGGAAACTCAGAGACAGGAAGG - Intronic
1076700574 10:132270695-132270717 TTACAGACGCAGAGGGAGGGAGG - Intronic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078101420 11:8332458-8332480 TTGGAGACCCATAGGCAGGCAGG - Intergenic
1078297573 11:10089200-10089222 TTGGAGACTTAAAGGTGGGAGGG - Intronic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079199758 11:18366029-18366051 TTGGAGACTGAAAGGAAAGAAGG + Exonic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081461514 11:43276617-43276639 TTGGGGACTCAGGGGAAGGGAGG - Intergenic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081575775 11:44317813-44317835 TTGCAGAATGAAAGGGAGGAGGG - Intergenic
1081620968 11:44619014-44619036 GCGGAGAGTCAGAGGGAGGCTGG - Intronic
1081744803 11:45465323-45465345 AGGGAGTCTCAGAGGGAGGGAGG - Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082820697 11:57542874-57542896 GTGGAATCTCAGAGGGAGGCTGG + Exonic
1082901510 11:58258474-58258496 TTGGAGACTCAGAGGGGAAGAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083400661 11:62421208-62421230 TTTGAGACTCACTGGGAAGATGG + Intronic
1084188933 11:67490222-67490244 CTGGAGGCTGAGGGGGAGGATGG + Intronic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084819779 11:71678241-71678263 TTGGGGACTCAGGGGGAAGGTGG + Intergenic
1085037046 11:73307116-73307138 TGTGAGACTCAGACGGAGGCAGG + Intergenic
1085094560 11:73749347-73749369 TTGGGGACTCACAGGGAAGTGGG + Intronic
1085428817 11:76428610-76428632 TTGGAGACTCCTTGGGAGCAAGG - Intergenic
1085813679 11:79712026-79712048 TTGGAGGGTCAGAGGAGGGAAGG - Intergenic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1087747587 11:101967254-101967276 TGGGAGACTGAGTGGGAAGATGG - Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1088843765 11:113648122-113648144 TCAGAGATTCAGAGAGAGGAAGG + Intergenic
1088907754 11:114167674-114167696 GTGCAGGCTCAGAGGAAGGAGGG - Intronic
1090168463 11:124576996-124577018 GTAGAGACTCATAGGCAGGAAGG + Intergenic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091097698 11:132839679-132839701 TCAGAGAGTGAGAGGGAGGAGGG - Intronic
1091849153 12:3681187-3681209 TGGGTCACTCAGAGGTAGGAAGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092191451 12:6524249-6524271 TTAGAGAATCAGAGCAAGGAGGG + Intronic
1092198290 12:6563424-6563446 TTTGGGGCTCAGCGGGAGGAAGG - Exonic
1092205761 12:6613531-6613553 TTGGGGAGTCTGAGAGAGGACGG + Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093350918 12:18102676-18102698 TTGCAGGCTCAGAGGCAGAAGGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094176392 12:27546107-27546129 TGGGAGTCACAAAGGGAGGAGGG + Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096196140 12:49649975-49649997 TTGGAGAATAAAAGGGATGAGGG - Intronic
1096836018 12:54351944-54351966 TAGGAGTCTCTGAGGTAGGAGGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097349499 12:58532970-58532992 TTAGTGAATCACAGGGAGGAAGG - Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098281835 12:68870051-68870073 TTGAAGAATCACAGGAAGGATGG + Intronic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099688203 12:85916570-85916592 TTGGAAACTCCGAGGAAGGAGGG - Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101649172 12:106659249-106659271 TTGGGGACCCACAGTGAGGAAGG + Intronic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102111084 12:110366260-110366282 ATGGAGACTGATAGGGAAGATGG + Intergenic
1102366012 12:112335365-112335387 TTGGGGACTCAGGGGGAAAAGGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1102930794 12:116860601-116860623 TTGGGGTCTAGGAGGGAGGATGG - Exonic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104462784 12:128969131-128969153 ACAGAGACTGAGAGGGAGGAAGG - Intronic
1104465390 12:128985693-128985715 TCGAGGGCTCAGAGGGAGGAGGG - Intergenic
1104481485 12:129111694-129111716 TGAGAGACTGAGAGGGAGGAAGG - Intronic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104814476 12:131637830-131637852 TGGGGCAGTCAGAGGGAGGAGGG + Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106442694 13:29791653-29791675 ATGGAAACTCTGAGGAAGGAAGG - Intronic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107550099 13:41465896-41465918 TAGGAGGCTCAGAGGGCAGAAGG + Intronic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108936693 13:55890918-55890940 TTTGAGGCTCAGAGGCAGAAGGG - Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110358138 13:74592936-74592958 TTGGAGAGTAAGGGAGAGGAGGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1110975612 13:81830252-81830274 TTGGAGACTTGGGGGGAGGATGG + Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1112255968 13:97831503-97831525 GTGGAGACTTAGAGGGAGCTAGG - Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113593299 13:111515301-111515323 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593316 13:111515359-111515381 TGTGAGAGTCTGAGGGAGGAGGG + Intergenic
1113593323 13:111515388-111515410 TATGAGAGTCTGAGGGAGGAGGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114767396 14:25389497-25389519 GTTAAGAGTCAGAGGGAGGAAGG - Intergenic
1114842573 14:26282465-26282487 ATGGAGACGGAGAGGGAGTAGGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115708168 14:36019567-36019589 TATGGTACTCAGAGGGAGGATGG + Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115762111 14:36584920-36584942 TTCGAGAACCTGAGGGAGGAGGG - Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116683812 14:48011824-48011846 TTGTAGACTCTGAGTGGGGAAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117243940 14:53864658-53864680 TTGAAGACTCAAAGGGAGAAGGG - Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117553591 14:56861388-56861410 GAGGAGACTGAGAGGGAGAATGG - Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1118380965 14:65217184-65217206 TTGGAGTCTGTGTGGGAGGAGGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118714176 14:68547656-68547678 TTGGAGTTTCAGAGCTAGGAGGG - Intronic
1119513933 14:75233357-75233379 TGGGAGGCTGAGCGGGAGGATGG - Intergenic
1119558513 14:75571575-75571597 TTGGAGACTCTGAGCTGGGAGGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120131716 14:80815941-80815963 CTGGAGACCCAGAGGGTGGGAGG + Intronic
1121551624 14:94807157-94807179 AAGGAGGCTAAGAGGGAGGAAGG - Intergenic
1121611626 14:95284771-95284793 TTGCAGACTCATAGGCAGAAGGG + Intronic
1121625779 14:95384579-95384601 TAGGAGACTCCAAGGAAGGAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122022914 14:98854108-98854130 TTAGGGACTCAGGGGGAGAATGG - Intergenic
1122356386 14:101125515-101125537 TAGGTGACTAAGAGGTAGGAAGG + Intergenic
1124911439 15:33925173-33925195 TTAGGGAATCATAGGGAGGAAGG - Intronic
1125141817 15:36417418-36417440 TTTGAGAGTCTGAGGGATGATGG - Intergenic
1125578008 15:40768154-40768176 TAAGAGTCTCGGAGGGAGGACGG + Intronic
1126256176 15:46627894-46627916 TTGCAGACTCATAGGCAGAAGGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126367636 15:47912404-47912426 TGGGAGACTGAGAGGGAGGTTGG + Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126504557 15:49389470-49389492 TTAGAGACTCAGAGCCGGGAGGG + Intronic
1126641251 15:50829353-50829375 TTGGGGACTCGGGGGGAGGCTGG + Intergenic
1126710065 15:51445233-51445255 TTGGAGTCCGTGAGGGAGGAGGG - Intergenic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126763567 15:51991765-51991787 GTGGAGATGCAGTGGGAGGATGG + Intronic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1126824973 15:52539875-52539897 TTGTAGACTCATAGGCAGAAGGG - Intergenic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127770473 15:62226492-62226514 TTGCAGACTGTGAGGAAGGATGG + Intergenic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129231392 15:74199037-74199059 TGGGAGAGCCAGAGGGAGGGTGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130759727 15:86806082-86806104 TTGGAGACTGGAAGGAAGGAAGG + Intronic
1131098184 15:89669212-89669234 TGGGAGACTCAGAGGGAAATGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131520285 15:93109405-93109427 TTGGAGGCGGGGAGGGAGGACGG - Intergenic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132542913 16:519657-519679 TGGGAGACTCAGAGATTGGAGGG + Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133003349 16:2862797-2862819 TTGGAGACTGGGAGGGTGGGAGG + Intergenic
1133286188 16:4691953-4691975 TTGAAGACTGTGAGGGTGGAGGG + Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134908425 16:18002215-18002237 TTGGGGACTCAGAGGGAAAGCGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135856852 16:26019597-26019619 TTGGAAACACACAGGGAGGGCGG + Intronic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136173227 16:28500659-28500681 TCAGAGAATCAGAGGGAGAAAGG + Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138441107 16:57035466-57035488 TTGGAGATTGAGTGGAAGGATGG - Intronic
1138814130 16:60184535-60184557 CTGGAGTCTTAGAGGGAGCATGG + Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139997999 16:70998639-70998661 GTGTAGAGTCAGAGGAAGGAAGG - Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140532804 16:75681713-75681735 TTGGGGACTCAGGGGAAGGGTGG - Intronic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1140754663 16:78056559-78056581 TGGGAGGCTAAGCGGGAGGATGG - Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141464881 16:84198760-84198782 TGGGAGAATCTGAGGGAGGTGGG + Intergenic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1143084773 17:4407364-4407386 TTGGAGGCCTAGTGGGAGGATGG + Intergenic
1143341394 17:6214059-6214081 TTGGGGGCTGAGAGGTAGGAGGG + Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143564193 17:7711760-7711782 TTGGGGACTCATGGGGAGAAGGG + Intergenic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144342297 17:14319924-14319946 TTGGGGACTCGGGGGGAGGGTGG - Intronic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1145890500 17:28411588-28411610 TTAGACACTGAGAGGAAGGAAGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146376114 17:32295624-32295646 TTGGTGCCTCAGGGTGAGGAAGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147241639 17:39094500-39094522 TTGTAGACTCAGAGTGGGGCCGG - Intronic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1148331144 17:46814710-46814732 CTGGAGACTGCGGGGGAGGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148874908 17:50681305-50681327 TTAAAGACTGAGAGGCAGGAAGG - Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149571958 17:57678404-57678426 TTGGGGACCCAGAGGAAGTAAGG + Intronic
1149681176 17:58508369-58508391 TCTGAGTCTGAGAGGGAGGAAGG - Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1151847987 17:76671502-76671524 TGGGAGCGTCAGGGGGAGGAAGG + Intergenic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153189288 18:2519960-2519982 TAGGAGACTGAGAGGTGGGAGGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153749492 18:8214096-8214118 TTGGAGACTCGGAGGGGGGCAGG + Intronic
1153924720 18:9825924-9825946 TGGGAGCTTCAGAGGCAGGAAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1155259711 18:24029660-24029682 TTGGGGACTCAGCGGGGGAAGGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155386171 18:25280176-25280198 TGGGAGAGTCTGAGGCAGGAGGG - Intronic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156310576 18:35918543-35918565 GTGGAGACCCAGAGGAGGGAAGG - Intergenic
1157487788 18:48100861-48100883 TGGGAACCTAAGAGGGAGGAGGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158447335 18:57532785-57532807 GAAGAGACTCAGAGGGAAGACGG - Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158971142 18:62667827-62667849 TGGGAGGCTCTGAGGCAGGAGGG - Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159372548 18:67546852-67546874 ATGGAGACTTTGAGGGACGATGG - Intergenic
1159626842 18:70704999-70705021 TTGGAGCCTCAGGGTCAGGAAGG + Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160277210 18:77448180-77448202 TTAGAGACTGTGAGTGAGGATGG + Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160566814 18:79791018-79791040 AGGGAGAATCAGAGGGAGAATGG - Intergenic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162679890 19:12333059-12333081 TTGAAGACTCAGAGGGACACCGG + Intronic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163328726 19:16622307-16622329 TTGGCGCCTCATAGGGAGGAGGG - Intronic
1163554172 19:17983197-17983219 TGGCAGTCTCAGAGGCAGGAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165969179 19:39611259-39611281 TTGGAGACTCGAAGGAAGGGTGG - Intergenic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167134323 19:47608338-47608360 TTGGAGCCTGACAGGGTGGAAGG - Intronic
1167253505 19:48414181-48414203 TCGTGGACTAAGAGGGAGGAGGG + Intronic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167398728 19:49250116-49250138 TTGGAGTTTCAGAGGGAGAGGGG - Intergenic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
1167588875 19:50391675-50391697 AGGGAGACTGAGAGGGGGGAGGG + Intronic
1167597154 19:50433778-50433800 GTGAAGACTCAGAGGGAGCCAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
924973219 2:150430-150452 AGGAAGACTCAAAGGGAGGAAGG - Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925880763 2:8350421-8350443 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
925993798 2:9275438-9275460 TGGGAGTATCAGAGGCAGGAGGG + Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927399677 2:22696520-22696542 TAGAGGACTCAGAGGGAGCATGG + Intergenic
928070430 2:28209528-28209550 TTGCCAACTGAGAGGGAGGAGGG + Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929528739 2:42731815-42731837 TTACAGACTCATAGGGAGAAGGG - Intronic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
930379761 2:50613224-50613246 TTAGTGACTCAGAGAGAGGCTGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931384948 2:61790120-61790142 TGAGAGACTGAGTGGGAGGATGG + Intergenic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933835578 2:86242871-86242893 TTGAAGAGTAAGTGGGAGGAAGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935110923 2:100093504-100093526 TTGGAGTCTGAGAGGAAGTAGGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936530265 2:113271421-113271443 TTGGAAAGGCAGAGGGAGGGAGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936816055 2:116462268-116462290 TTGGAAAGGCAGGGGGAGGAGGG + Intergenic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939946431 2:148416774-148416796 TTGGATACTCAGATGAGGGAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941530769 2:166667834-166667856 TTAGGGACTCAGAGGGGGAAGGG + Intergenic
941702611 2:168620259-168620281 TTGGGGACTCAGGGAAAGGATGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942062272 2:172238861-172238883 TGGTAGACTCAGATGAAGGAAGG + Intergenic
942213474 2:173694892-173694914 TTGGAGACTCGGTGGGAGAAGGG + Intergenic
942450092 2:176103923-176103945 TTGGGAACTCAGAGGGCGGCGGG + Intergenic
942811109 2:180002252-180002274 TTGGTGACTTACAGGGAGTAAGG - Intronic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
944197614 2:197072009-197072031 TTTGTGACTGAGAGGGAGGGAGG + Intronic
944373931 2:199017915-199017937 TTGGAAGGTCAGAGTGAGGAAGG + Intergenic
945437149 2:209832143-209832165 TTGAGGACTCAGGGGGAGGGTGG + Intronic
945580425 2:211587550-211587572 CTAGAGACTTAGAGGGAGCATGG + Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946059279 2:216927699-216927721 TTAGAGACTGAGAGGGGGCAGGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946668089 2:222072404-222072426 GTGGACACTCAGAGGGCAGATGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947380431 2:229540217-229540239 GTAGAGACTCAGGGGGAGCAGGG + Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169184840 20:3605745-3605767 TTGGAGAGTGATGGGGAGGAAGG + Intronic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172154066 20:32811193-32811215 TGGGGGACTCAGAGGGAGTATGG + Intergenic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174568025 20:51481001-51481023 TTGGAGTGTCAGAGGAAAGAGGG + Intronic
1174865316 20:54130230-54130252 TTAGAAATGCAGAGGGAGGATGG + Intergenic
1175003254 20:55653373-55653395 TAGGAGACTCAGAGGGCTGGTGG - Intergenic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175152075 20:56942885-56942907 TTGGCAACTCTGAGGGGGGAAGG - Intergenic
1175749482 20:61485408-61485430 TTGGATCCACAGAGGAAGGAGGG - Intronic
1175961427 20:62638695-62638717 TGGGAGATGCAGAGGGAGGGCGG + Intergenic
1175966287 20:62661670-62661692 TCAGAGACTCTGAGGGAGGGAGG - Intronic
1177367869 21:20160935-20160957 TTGGAGTCTCCAAGGGAGAAGGG + Intergenic
1177620833 21:23590968-23590990 TTACAGACTCAGAGGCAGAAGGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1178741550 21:35206621-35206643 TCAGAGACACAGAGAGAGGAGGG - Intronic
1178913211 21:36692989-36693011 TCGGAGAGTGGGAGGGAGGATGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179548349 21:42126781-42126803 GTGGAGACTCAGTGGAAGGTGGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180189866 21:46157701-46157723 GTGGAGCCTCAAGGGGAGGATGG + Intergenic
1180261792 21:46675242-46675264 TTGGAGGCTCTGAGGCAGGAGGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181787654 22:25238447-25238469 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1181819390 22:25463485-25463507 TTGGAGATACAGCGGGAGGGAGG + Intergenic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184235700 22:43181981-43182003 GGGGAGACTCAGGGGGATGAAGG + Intronic
1184362515 22:44026813-44026835 TTGAGGACTCTAAGGGAGGAGGG + Intronic
1184691324 22:46118623-46118645 CTGGAGGCTGAGCGGGAGGAAGG - Intergenic
1184910966 22:47533871-47533893 ATGGGGACTCAGTGGGACGAAGG + Intergenic
1184968824 22:48000655-48000677 TTGGGGACTCAGGGGAAGGATGG - Intergenic
1185420442 22:50731656-50731678 TTGGTGACTCGGGGGGAGGGGGG + Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949799668 3:7889952-7889974 TTGGGGACTCAGGGGGAAGGTGG + Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950458877 3:13109252-13109274 TGGGAGAATGGGAGGGAGGAGGG - Intergenic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
952195211 3:31068303-31068325 GTGGAGTCACAGAGGGAGGGAGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952501923 3:33971019-33971041 TTGGAGAGTCAGAGGTAGGTTGG + Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952672024 3:35980925-35980947 TGGGAGGCTGAGAGGTAGGAGGG - Intergenic
952732974 3:36659158-36659180 TTGGGGACTCGGAGGGAAGGTGG + Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953103434 3:39852542-39852564 TTGGGGACTCAGGGGGAAGGGGG - Intronic
953216599 3:40924183-40924205 TTGGAGGGTGGGAGGGAGGAGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954424448 3:50435987-50436009 TTAGAGACACAGGGTGAGGAGGG + Intronic
954479277 3:50782793-50782815 TTGGGGACTCGGTGGGGGGAAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954623550 3:52009682-52009704 TGGGAGATTGAGAGGGGGGAAGG - Intergenic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956377372 3:68629237-68629259 TTGGAGATTCAGAGGATGGGAGG - Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956707429 3:72011434-72011456 TTGGAGACTCCCAGGAAGCATGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957012041 3:75017901-75017923 TTGCAGAATCAGAGGTAGCATGG + Intergenic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959871087 3:111329334-111329356 TTGAAGACCAAGAGGGATGAAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960079813 3:113529550-113529572 GTAGAGACTCAAAGGCAGGAAGG + Intergenic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960553276 3:119000705-119000727 TTGAAGACTCAAAGGGAGAAGGG + Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
964022348 3:152028285-152028307 TAGGAGACTCAGAGGGAGAGAGG + Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964868129 3:161284103-161284125 TTGGGGACTCAGGGGAAGGCGGG + Intergenic
965030417 3:163358442-163358464 TTGAAGAATTAGAGGGAGCAAGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965292353 3:166899661-166899683 TAGAAGACTCAGAGGAAGCAGGG - Intergenic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967438782 3:189481903-189481925 TTGGAAACTCACAGTCAGGAGGG + Intergenic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
968981782 4:3854115-3854137 TTTGAGGCTGAGAGGCAGGAGGG - Intergenic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969187326 4:5486186-5486208 GTGGAGTCTCAGAGGCAGGCTGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970200161 4:13596297-13596319 TTCTAGACTCAGAGACAGGAGGG - Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
971455061 4:26836415-26836437 TTGGAGGGGCAGAGGGAGGTGGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976998241 4:91462900-91462922 GTGGAGTCTCAGAGGTAGGCAGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977379058 4:96247210-96247232 TCAGAGACTCAGGGGGAGCATGG - Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978132286 4:105213691-105213713 ATGGAGACTCATAGGAAGGTGGG - Intronic
978411845 4:108434483-108434505 TTCAAGCCTCAGAGGAAGGATGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979000374 4:115209886-115209908 TTGGGGACTCAGGGGAAGGGTGG + Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980496986 4:133598821-133598843 TTGGAATCTCTGTGGGAGGAGGG + Intergenic
980546232 4:134266742-134266764 TTGGAGAATGATAGGGATGATGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981156119 4:141438353-141438375 TAGAAGACACAGAGGGAAGAAGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982172617 4:152676377-152676399 TTGGAAACCCAGAGGTAGTATGG + Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982401560 4:154973398-154973420 TTAGAGACTCAGAGCCAGCAGGG - Intergenic
982448368 4:155521953-155521975 TCGGGGACTAAGAGGGAGGATGG - Intergenic
982488451 4:155998340-155998362 TTGGAAACTCAGAGGATGGGAGG - Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983881751 4:172940776-172940798 TAGGAGGCTGAGATGGAGGATGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984709996 4:182876798-182876820 TTGTAGATTCAGAGTGAGGTGGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984836566 4:184027955-184027977 TGTGAGGTTCAGAGGGAGGAGGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
986263141 5:6166653-6166675 CTGGAGAGTGAGAGGTAGGAAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986958341 5:13183381-13183403 ATGGAGATTCAGAGGGTGGGAGG - Intergenic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988170815 5:27652958-27652980 TTACAGACTCATAGGCAGGAGGG + Intergenic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990873261 5:60456698-60456720 TTGTAGACTGAGAGTAAGGAAGG - Intronic
990979296 5:61587340-61587362 TTGGTGACTCAGATGCAAGACGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991710603 5:69404833-69404855 TTGGAGGCTGAGTGGGAGGATGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994382584 5:99088796-99088818 TGGTAGTCCCAGAGGGAGGAGGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994956878 5:106544353-106544375 TGGGAGATCCAGAGGGAGGACGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995749563 5:115440063-115440085 TAGTAGAGTCAGAGGGAGAAGGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997422609 5:133781067-133781089 GTGAAGAGTCAGAGGAAGGAGGG - Intergenic
997675170 5:135707382-135707404 TTGCAGACTCAGTGGGAGTTTGG - Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000079639 5:157832765-157832787 TTGGATATTCAGTGGGAGGAAGG - Intronic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1001045935 5:168371591-168371613 TTCCAGACTTGGAGGGAGGATGG - Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002949782 6:1798609-1798631 TTGGAGATTCAGCGGGTGGCTGG - Intronic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004443086 6:15672205-15672227 GTGGAGACTGAGGGGGAGGTGGG + Intergenic
1004673563 6:17820259-17820281 TGGGAGTCTCAGAGGAAGGACGG - Intronic
1004681726 6:17902266-17902288 TTGGAGAATGAAGGGGAGGATGG - Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005844270 6:29765490-29765512 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1005856375 6:29866282-29866304 ATGGAGTGTCTGAGGGAGGAGGG - Intergenic
1006081322 6:31568850-31568872 TGAGAGACACAGAGGAAGGAAGG - Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1008287326 6:49669968-49669990 TTAGAGAACTAGAGGGAGGAAGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009435215 6:63609858-63609880 TGGGAGAGTGAGAGGGAGGTGGG + Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011364234 6:86563189-86563211 TTGGAGATTCAGAGGGGGTCAGG - Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011653006 6:89524304-89524326 TTGGGGACTCAGGGGAAGGTGGG - Intronic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014096627 6:117468472-117468494 TTGGAGACTCGGGGGAAGGGTGG - Intronic
1014376653 6:120683823-120683845 TTGGGGACTCAGGGGAAGGCTGG + Intergenic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014397476 6:120943764-120943786 TTGGAGAATGTGGGGGAGGATGG - Intergenic
1014792260 6:125686758-125686780 TTGGGGATTCAGGGGGAAGAGGG - Intergenic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015825873 6:137311210-137311232 TGGGATGCTGAGAGGGAGGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018652033 6:165999994-166000016 CTGGAGACTGAGAGCAAGGAGGG - Intergenic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019388008 7:769387-769409 ATGGAGACTTACAGGGAGGCGGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019803011 7:3102520-3102542 TGAGAGTCTCAGAGGCAGGATGG - Intergenic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020741753 7:12028656-12028678 TTGGAGGCTGTGAGGGAGAATGG - Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021027007 7:15681659-15681681 TTTGAAACACAGAGGGAGAATGG + Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021376924 7:19919971-19919993 CTAGAGACTGGGAGGGAGGAGGG + Intergenic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1023119163 7:36892205-36892227 TGGCACACACAGAGGGAGGAGGG + Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1024062283 7:45708178-45708200 TAGGAGACTAAGAGAGAGGCAGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1025227465 7:57177795-57177817 TTAGTGACGCAGAGGCAGGAGGG + Intergenic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026837697 7:73649401-73649423 GGGGGGACTCAGAGGGAGCATGG - Intergenic
1027141629 7:75661790-75661812 TTGGAGCCACTGGGGGAGGATGG + Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027635366 7:80665916-80665938 TGGGAGAATTAAAGGGAGGAAGG + Intronic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028308381 7:89295985-89296007 TTAGAGACTCGGAAGGAGTAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1028974265 7:96894027-96894049 TGGGAGACCTAGAGGCAGGATGG - Intergenic
1029669755 7:102021411-102021433 TTGGAGGCTGAGGTGGAGGATGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030301057 7:107975487-107975509 TGTGAGATTTAGAGGGAGGAAGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030617869 7:111757115-111757137 GCGGAGGCTGAGAGGGAGGAGGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031075493 7:117208474-117208496 TATCAGACCCAGAGGGAGGAAGG + Intronic
1031598438 7:123673928-123673950 GTGGAGTCTTTGAGGGAGGAGGG - Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1033054287 7:138035284-138035306 TTACAGACTCATAGGTAGGAGGG - Intronic
1033814677 7:145057437-145057459 CTGGAGGCTCTGGGGGAGGATGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034534745 7:151719790-151719812 TGGCAAACTCAGGGGGAGGAGGG - Intronic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1034964531 7:155383030-155383052 TTGGGGGCTGAGTGGGAGGACGG + Intronic
1035081083 7:156216546-156216568 TTGGAGACTCAGAGACAGACAGG - Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035585544 8:770268-770290 TGCGTGGCTCAGAGGGAGGATGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036754871 8:11465432-11465454 TTGAAGACTGATGGGGAGGATGG + Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037211498 8:16393710-16393732 TTGGGGACTCAAAGGGTGGGAGG + Intronic
1037633665 8:20680449-20680471 TTGGAGCATGTGAGGGAGGAAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039431136 8:37526047-37526069 TTGGGGACTCAGGGGGAAAAAGG + Intergenic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040370248 8:46763644-46763666 TTGGAGACTCGGGGGAAGGGTGG + Intergenic
1040393889 8:46976123-46976145 ATGGAGACGCAGCGGGTGGAAGG + Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041500984 8:58538476-58538498 TGGGAGACAGAGAGGGAGAAGGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042101626 8:65280813-65280835 TTGGAGACACACAGGGAAGCAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043251973 8:78086366-78086388 TGGGAGACTCTGTGGGAGAAAGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048102006 8:131362531-131362553 TTGGAGACTCAGAGGGTGAGTGG + Intergenic
1048129519 8:131678917-131678939 TTCAAGACTCAGTGGGAGGATGG + Intergenic
1048406914 8:134132547-134132569 TTGTAGACTCAGCTGTAGGAAGG - Intergenic
1049343226 8:142124861-142124883 TGGGAGCTTCAGAGGGAGCAAGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049465963 8:142751448-142751470 TGGGAGACTCAGGGGGACCAAGG + Intronic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050312027 9:4362898-4362920 TTGAGGAGTTAGAGGGAGGAAGG + Intergenic
1050435959 9:5611016-5611038 TTGGGGACTCAGAGGAAGAGTGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052853494 9:33392616-33392638 TTGGAACCTCGGAGGCAGGAGGG - Intronic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1052962818 9:34315257-34315279 GGGGAGGCTGAGAGGGAGGAAGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053681517 9:40488796-40488818 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053931512 9:43117126-43117148 TTGGAACCTCGGAGGCAGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054282196 9:63136138-63136160 TTGGAGCCTCGGAGGCAGGAGGG + Intergenic
1054294608 9:63324313-63324335 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054392630 9:64628800-64628822 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054427278 9:65134009-65134031 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054503098 9:65887531-65887553 TTGGAGCCTCGGAGGCAGGAGGG + Intronic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054741823 9:68813842-68813864 ATCGAGTCTCAGAGGGAGCATGG + Intronic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057135429 9:92684211-92684233 TTTGAGAGTCTGAGGCAGGAGGG + Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057804814 9:98212460-98212482 TTGGGGGCCCAAAGGGAGGAAGG - Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058582076 9:106469222-106469244 TCGGAGGCTCAGAGGGGGAAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058935139 9:109763192-109763214 AGGGAAACTCAGAGGGCGGAGGG + Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059193654 9:112350207-112350229 TTGGGGACTCAGAGGGTAAAGGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059264779 9:113016885-113016907 TTTGGGAGTCAGAGGCAGGAGGG + Intergenic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059437763 9:114286856-114286878 TGGGAAACTGAGAGGAAGGAAGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060434342 9:123580854-123580876 TTGCTGCCTCAGAGGGAGGCGGG + Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062218122 9:135399993-135400015 GTGGGGTCTGAGAGGGAGGAAGG + Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1062668593 9:137693170-137693192 TTGGAGACGCACAGTGAGGCCGG + Intronic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186014871 X:5180109-5180131 TTGGGGAGTAAGAGGGATGAAGG + Intergenic
1186407712 X:9318208-9318230 TTGGTGACTTCCAGGGAGGATGG + Intergenic
1186410714 X:9342603-9342625 TGGAAGACTAAGAGGGAGGAGGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186997161 X:15135912-15135934 TTGGAGACTCAGGGGGGAAAGGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187212192 X:17242741-17242763 TTAGAGACTCTGAGGGACCATGG + Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187589325 X:20699194-20699216 TTGGGGACTCAGGGAAAGGATGG + Intergenic
1187716030 X:22103459-22103481 TTGGGGACTCAGGGGGAGAGTGG - Intronic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188208509 X:27389947-27389969 GTGGAGACTCAAAGGCAGGCAGG - Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189946414 X:46184589-46184611 TGGGAGGCACAGAGGGATGAAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190648338 X:52544053-52544075 TCGGTGACTCTGAGGGAGAAGGG + Intergenic
1190679334 X:52811466-52811488 TTGGTGACTCCGAGTGAGAAGGG + Intergenic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190896717 X:54626183-54626205 TTAGAGACTGGGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192290745 X:69792118-69792140 TTGGGGACTCAGTGGGGGAATGG - Intronic
1192429762 X:71103859-71103881 TAGGAGGCTCTGAGGGTGGATGG - Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1193912971 X:87327989-87328011 TTGGTGGCTCACAGGGATGAGGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195446746 X:104960713-104960735 TTAGATACTTGGAGGGAGGAGGG - Intronic
1195498826 X:105570122-105570144 TTGGGGACTCAGGGGAAGGTGGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197970888 X:132113914-132113936 TTGGAGACTTGGGGGGAGGTGGG - Intronic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198445148 X:136705996-136706018 TTGGAGACTAAGATGCAGAATGG - Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199119177 X:144030257-144030279 TTACAGACTCATAGGGAGGAGGG + Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic