ID: 1028409970

View in Genome Browser
Species Human (GRCh38)
Location 7:90519835-90519857
Sequence ATGAAGGAGGTGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2407
Summary {0: 1, 1: 0, 2: 21, 3: 195, 4: 2190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028409970_1028409973 -9 Left 1028409970 7:90519835-90519857 CCTTCTTCCTTCACCTCCTTCAT 0: 1
1: 0
2: 21
3: 195
4: 2190
Right 1028409973 7:90519849-90519871 CTCCTTCATTCTTCTTTGTTTGG No data
1028409970_1028409974 -8 Left 1028409970 7:90519835-90519857 CCTTCTTCCTTCACCTCCTTCAT 0: 1
1: 0
2: 21
3: 195
4: 2190
Right 1028409974 7:90519850-90519872 TCCTTCATTCTTCTTTGTTTGGG 0: 1
1: 0
2: 13
3: 118
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028409970 Original CRISPR ATGAAGGAGGTGAAGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr