ID: 1028413420

View in Genome Browser
Species Human (GRCh38)
Location 7:90555326-90555348
Sequence CTTTCTACGCTGATGATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028413420_1028413422 -6 Left 1028413420 7:90555326-90555348 CCAACTATCATCAGCGTAGAAAG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1028413422 7:90555343-90555365 AGAAAGACAACCTACAGAGTGGG No data
1028413420_1028413421 -7 Left 1028413420 7:90555326-90555348 CCAACTATCATCAGCGTAGAAAG 0: 1
1: 0
2: 1
3: 1
4: 59
Right 1028413421 7:90555342-90555364 TAGAAAGACAACCTACAGAGTGG 0: 1
1: 4
2: 230
3: 2930
4: 6690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028413420 Original CRISPR CTTTCTACGCTGATGATAGT TGG (reversed) Intronic
908648824 1:66309985-66310007 TTTTCCAGGCTGATGATAGCAGG + Intronic
909494421 1:76262498-76262520 CTTTCTATGATGTTGATATTTGG + Intronic
909568061 1:77077778-77077800 CTGTCTACGCTGAAAATACTTGG - Intergenic
910681208 1:89866954-89866976 CTTGCTACCCTGATGATGTTTGG - Intronic
914833838 1:151190799-151190821 TTTTCTACACTGCTGCTAGTAGG + Intronic
916621933 1:166508136-166508158 CTTTCTATGATGATGGCAGTGGG + Intergenic
1065333839 10:24634003-24634025 CTTTCTACTCTGAGTAGAGTAGG + Intronic
1068881929 10:62058958-62058980 CTTGCTCTGCTGATGACAGTAGG + Intronic
1070645485 10:78199295-78199317 CTTTTTAGGCTGATAATACTTGG + Intergenic
1072068818 10:91896841-91896863 CCTTCACCGGTGATGATAGTGGG - Intergenic
1072215635 10:93285167-93285189 CTTGTTACGCAGATGAAAGTCGG + Intergenic
1075949080 10:126461961-126461983 CTTACTACACTGATGATATAAGG + Intronic
1091079864 11:132656191-132656213 CTTTACATGGTGATGATAGTTGG + Intronic
1097051600 12:56226460-56226482 CTTTCTAGGCTGAGGAGAGTGGG - Intronic
1097990953 12:65833327-65833349 CTTTCTAGGCTTTGGATAGTGGG + Intronic
1099281857 12:80660005-80660027 CTTTCTAAGGTGAAGATTGTAGG - Intronic
1101351682 12:103935522-103935544 CTTTCTAGGATGAAGAAAGTTGG - Intronic
1110555331 13:76853207-76853229 CTGTCAACTCTGGTGATAGTAGG - Intergenic
1114341672 14:21752056-21752078 CTTTCAGCACTGATGATACTGGG + Intergenic
1117604706 14:57416080-57416102 ATTTTTATCCTGATGATAGTGGG + Intergenic
1121062000 14:90920489-90920511 CTTTCTGTGCTGAGGATACTTGG - Intronic
1121841572 14:97138695-97138717 CTTTCTAACCTGATGCCAGTGGG + Intergenic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1135169188 16:20168214-20168236 CTATCTAGGCTGATGATATCAGG + Intergenic
1146091381 17:29882300-29882322 CTTTTGATGGTGATGATAGTGGG - Intronic
1149327372 17:55545748-55545770 CTATATACGCTGTTGATCGTTGG - Intergenic
1159172834 18:64795165-64795187 CTTTCTAAGATGAAGAGAGTCGG - Intergenic
1159201968 18:65198110-65198132 CTTTCTACACTTATGCCAGTAGG - Intergenic
1168302149 19:55411261-55411283 CTTTTTACCCTGAGGACAGTTGG + Intergenic
937680840 2:124642702-124642724 CTTTCTCCCCAGATGATGGTAGG + Intronic
940732631 2:157411373-157411395 CTTCATAAGCAGATGATAGTAGG - Intergenic
945697457 2:213125767-213125789 CTTTATACACTGATGATACATGG - Intronic
1169883215 20:10369785-10369807 CCTTCTAAGTTGGTGATAGTTGG + Intergenic
1170405770 20:16034448-16034470 CTTTTTAAGCTAATGATTGTTGG - Intronic
1173552181 20:43940164-43940186 CTTTCTACCTTGAGGACAGTGGG + Intronic
1173898049 20:46565830-46565852 GTTTCAACACTGTTGATAGTTGG - Intronic
1176104899 20:63381317-63381339 CTTTCTCCTCTGATGGAAGTCGG - Intergenic
1179417036 21:41207310-41207332 CTTCATACTTTGATGATAGTTGG - Intronic
1180065310 21:45409345-45409367 CCTTATACGATGATGATATTTGG + Intronic
957346068 3:78963114-78963136 CTTGCAATGCTGATGATAGGAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963153653 3:142073290-142073312 TTTTGTACGCTACTGATAGTAGG + Intronic
965440368 3:168705619-168705641 CTTTCTACACTCTTGCTAGTTGG + Intergenic
968761473 4:2444514-2444536 CTTGATAGGCTGATGATGGTGGG + Intronic
970863239 4:20728726-20728748 ATTTCTACACTGGTGATAGCAGG + Intronic
984515095 4:180728018-180728040 CTTTATACTCTGAAGATAGGAGG + Intergenic
989181402 5:38580906-38580928 CTTTCTAGGCTTCTGAGAGTGGG + Intronic
998187453 5:139992484-139992506 CTTTTTGCACTGATGATAGGGGG + Intronic
1017433042 6:154390263-154390285 CCTTCTAGGCTGATTAGAGTTGG + Exonic
1028140306 7:87266232-87266254 TTTTCTACTCTTGTGATAGTTGG - Intergenic
1028301980 7:89211296-89211318 CTGTTTTCTCTGATGATAGTGGG + Intronic
1028413420 7:90555326-90555348 CTTTCTACGCTGATGATAGTTGG - Intronic
1030735842 7:113047669-113047691 CTATCTATGGTGATGATGGTGGG - Intergenic
1033563125 7:142553115-142553137 CTTTCTCCACTGATGCCAGTGGG + Intergenic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1043336759 8:79185604-79185626 CTTCCTATGCTCATGATATTAGG - Intergenic
1051911683 9:22159917-22159939 GTTTGGAGGCTGATGATAGTGGG + Intergenic
1052140167 9:24971486-24971508 CCTTTTACTCTAATGATAGTTGG + Intergenic
1053093879 9:35307242-35307264 CTTTCTCGGGTGATGATACTGGG + Intronic
1058869161 9:109187669-109187691 TTTTCTTCTCTGATGATAGCAGG + Intronic
1188276289 X:28205639-28205661 TTTTATAAACTGATGATAGTTGG + Intergenic
1196648347 X:118142619-118142641 CATTCTACAATGATGATATTTGG + Intergenic