ID: 1028417583

View in Genome Browser
Species Human (GRCh38)
Location 7:90596366-90596388
Sequence CGCGCTCGCCGCCGCCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028417583_1028417594 23 Left 1028417583 7:90596366-90596388 CCACCACGGCGGCGGCGAGCGCG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1028417594 7:90596412-90596434 CGCCCCCGCCCGCCCAGCTGCGG 0: 1
1: 2
2: 4
3: 39
4: 387
1028417583_1028417599 29 Left 1028417583 7:90596366-90596388 CCACCACGGCGGCGGCGAGCGCG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028417583 Original CRISPR CGCGCTCGCCGCCGCCGTGG TGG (reversed) Intronic