ID: 1028417583

View in Genome Browser
Species Human (GRCh38)
Location 7:90596366-90596388
Sequence CGCGCTCGCCGCCGCCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028417583_1028417599 29 Left 1028417583 7:90596366-90596388 CCACCACGGCGGCGGCGAGCGCG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417583_1028417594 23 Left 1028417583 7:90596366-90596388 CCACCACGGCGGCGGCGAGCGCG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1028417594 7:90596412-90596434 CGCCCCCGCCCGCCCAGCTGCGG 0: 1
1: 2
2: 4
3: 39
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028417583 Original CRISPR CGCGCTCGCCGCCGCCGTGG TGG (reversed) Intronic
900162835 1:1232434-1232456 CGCGCGCGCCGCCGCCTTCCTGG + Exonic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900786924 1:4655221-4655243 CCGGCGCGCCGCCGCCGTTGGGG - Exonic
902400834 1:16155863-16155885 TGCGCTGGCCGCGGCCGCGGCGG - Exonic
903034192 1:20484286-20484308 CGCGCTCCCCGCTGCCGCAGAGG + Intronic
903349953 1:22711333-22711355 CGCGCTCGCCGCCCCCGGCTCGG + Intronic
903883690 1:26529575-26529597 CGCGCTCGGCTCCGCCGGAGAGG - Intergenic
905137142 1:35808401-35808423 GGCCCCCGCCGCCGCCATGGAGG + Exonic
905752392 1:40477355-40477377 CGCTCTCGCTGCAGCCCTGGCGG - Exonic
905807009 1:40884465-40884487 CGCGCTCACCACCACCGCGGAGG + Intergenic
908131843 1:61082376-61082398 CGCTCGCGCCGCCGCCGCGGGGG - Intronic
914293632 1:146298119-146298141 TGCTCCGGCCGCCGCCGTGGGGG - Intergenic
914554676 1:148748902-148748924 TGCTCCGGCCGCCGCCGTGGGGG - Intergenic
915142494 1:153776124-153776146 CGCGCGCGCCGCAGCTGCGGAGG - Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
917846690 1:179026015-179026037 CGCCCCCGCCGCCTCCGGGGAGG - Exonic
917904479 1:179575669-179575691 AGCGCCCGCCGCCACGGTGGTGG - Exonic
921167019 1:212514803-212514825 CGCGCTCGGGGCCCACGTGGCGG - Intergenic
923372557 1:233327962-233327984 CGCGCCCGCGGCCGCCCGGGAGG + Exonic
924740652 1:246792748-246792770 AGCCCTCGCGGCCGCCCTGGGGG + Intergenic
1064086507 10:12349656-12349678 CGCTCTCGCCGCCGCCGCCGCGG - Exonic
1064384511 10:14878715-14878737 CGCGCTGGCCGCCGCGGCGGGGG + Intergenic
1065660265 10:27998877-27998899 CGCGCACGCCGGCGCCCTTGTGG + Intronic
1065687772 10:28302980-28303002 CGGGCTCGGCACCGCCGCGGCGG + Intronic
1070179229 10:73998330-73998352 CGCGCCCGTGGCCGCCGTGCAGG + Exonic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071690877 10:87818292-87818314 CGCGGTCGCCGGCGCGGAGGGGG + Intronic
1072089632 10:92115038-92115060 CGCGCCCGCGGCCGCCGGGGCGG - Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1073414236 10:103368118-103368140 CGTTCCCGCCGCCGCCGTTGGGG - Exonic
1076373058 10:129967214-129967236 AGCGGTCGCCGCAGCCGTCGCGG - Intergenic
1076638910 10:131901015-131901037 CGCCGCCGCCGCCGCCGGGGAGG - Exonic
1080606633 11:33869625-33869647 CGGGCGCGCCGCGGCCGAGGCGG + Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084310333 11:68312878-68312900 CGCGGGCGCCGCCGCCGTCTCGG + Intronic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1093736433 12:22625385-22625407 CGCCGTCGCCGTCGTCGTGGTGG + Exonic
1097237001 12:57547057-57547079 CCGTCTCGCCGCCGCCATGGCGG - Exonic
1100309181 12:93378272-93378294 TGCTCCGGCCGCCGCCGTGGGGG - Exonic
1100978086 12:100142822-100142844 GGCGCCCGCGGCGGCCGTGGCGG - Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102933978 12:116881694-116881716 CGCGCTCCGCGCCTCCGCGGGGG - Intergenic
1105011938 12:132761897-132761919 CGCGCTCGAGGCGGCCGGGGCGG + Intergenic
1105012025 12:132762124-132762146 CGCGCCCGGCCCCGCCCTGGTGG - Intergenic
1106516959 13:30464715-30464737 CGCGCTCGCCCTCGCGGCGGCGG - Intronic
1107468027 13:40666652-40666674 CGCGCGCGCCGCCGCGGGCGGGG - Intergenic
1107951345 13:45465020-45465042 CGCCATCGCCGCCGCCCTCGCGG - Exonic
1108408132 13:50124705-50124727 CGCCCGCCGCGCCGCCGTGGCGG - Intronic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1116657926 14:47674744-47674766 TCCGCTCGCCGCCGCCGCCGGGG - Exonic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1118220692 14:63852870-63852892 CGCGCCCGCCAGCGCCGGGGCGG - Intergenic
1118576030 14:67241695-67241717 CGCGCGAGCTGCGGCCGTGGAGG + Intronic
1118887572 14:69879565-69879587 CCCGCTCCCCGCCGCCGCGAGGG + Exonic
1119407472 14:74407600-74407622 CACACTCGCCATCGCCGTGGGGG - Exonic
1122221034 14:100239208-100239230 CGAGGCCGCCGCGGCCGTGGCGG + Exonic
1122552061 14:102555556-102555578 CGCTCTCGCGGCCGCCGGCGGGG - Intergenic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1131827051 15:96330510-96330532 TGCGCCCGCGGCCGCCATGGCGG + Intronic
1132544791 16:528093-528115 CGCGCTCCCCGCCGCCCTCCGGG - Intronic
1132837093 16:1959609-1959631 CGCGCCCGCCGCCGCCATGCCGG + Exonic
1132865874 16:2092491-2092513 CGCACCTGCCGCAGCCGTGGGGG + Exonic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1134529883 16:14975082-14975104 CGCGCCCGCGGCCGGCGGGGCGG - Exonic
1136536393 16:30902323-30902345 GGCCCTGGGCGCCGCCGTGGAGG + Exonic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1139761435 16:69187385-69187407 CGCCCGCGCCGCCGCCGTTTGGG - Exonic
1141608758 16:85169894-85169916 GGCGCAGGCGGCCGCCGTGGCGG + Intergenic
1141683378 16:85556643-85556665 CGCTCGCTCCGCCGCCGCGGCGG - Intergenic
1142136283 16:88453360-88453382 CGCACTCGCCGCCGCCGCCGCGG - Exonic
1142978330 17:3657998-3658020 CGCGCTGGCCACCGCGCTGGGGG - Exonic
1143510973 17:7394773-7394795 CACGCACGCCGCCGGCCTGGCGG - Exonic
1146398657 17:32487295-32487317 CCCGCCCGCCGCCGCCGCTGCGG - Intronic
1148207000 17:45785158-45785180 CGCGCTCCCAGCCGCGGTCGGGG - Intronic
1148664080 17:49361863-49361885 CGCACTCGCCACCGCCGCGGCGG - Intronic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1160735937 19:662505-662527 AGCCCTGGCCGCCGCCTTGGAGG - Intronic
1161791318 19:6361862-6361884 CGCGCTCGCCGCGACCCTGGGGG - Exonic
1162410684 19:10503258-10503280 CGCGGGCGCCTCCGCCGTCGGGG + Exonic
1163843970 19:19628305-19628327 CGCCCCCGACGCGGCCGTGGAGG - Intronic
1164639072 19:29811813-29811835 CTCGCGGGCCGGCGCCGTGGAGG + Intergenic
1164834882 19:31350200-31350222 CGCGCCCGCCTCCTCCCTGGAGG - Intergenic
1167072323 19:47228212-47228234 CGCCGTCACCGCCGCCCTGGGGG - Exonic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
926914406 2:17878690-17878712 CGCTCTCCTCGCCGCCGCGGCGG + Intronic
930730479 2:54723847-54723869 CGCGCGCACTGCCGCCCTGGCGG - Intronic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934978751 2:98823303-98823325 CGCGCTCACGGCCAGCGTGGAGG - Exonic
935592618 2:104855840-104855862 TGCCGCCGCCGCCGCCGTGGAGG + Exonic
942446190 2:176080404-176080426 CGCGCCGGCCGCCGCCGCCGAGG + Exonic
948876554 2:240832679-240832701 CGCTCTCACCGCAGCCGGGGAGG - Intergenic
1172118733 20:32585525-32585547 CGCGCCCGCAGCCGCCGGGAGGG + Intronic
1172474441 20:35226636-35226658 CGCGCGCCCCGCCCCGGTGGGGG - Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176548642 21:8212363-8212385 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556536 21:8256571-8256593 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567573 21:8395398-8395420 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575475 21:8439613-8439635 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1178351135 21:31873652-31873674 CGCGCTCGCCGCGGCCCGCGCGG - Exonic
1180708287 22:17822915-17822937 CGCCCTCCCCGCCCCTGTGGTGG - Intronic
1181934455 22:26429112-26429134 CGCGCCCGCCGCCGCTCCGGAGG - Intergenic
1182236952 22:28883653-28883675 CGCCGCCGCCGCCGCCGTGATGG + Exonic
1184240735 22:43210217-43210239 CAAGCTCGCCGCCGCAGTGCTGG + Exonic
1203238469 22_KI270732v1_random:30916-30938 CGCCGCCGCCGCCGCCGGGGCGG + Intergenic
1203253525 22_KI270733v1_random:128668-128690 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203261580 22_KI270733v1_random:173746-173768 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
953485080 3:43286931-43286953 CGCGGCCGCCGCCGCAGTGACGG - Intronic
954909028 3:54087776-54087798 CGCAGTCCCCGCCGCCGCGGGGG + Intergenic
954912782 3:54122670-54122692 CGCTCTCGTCGCCGCCGCAGCGG + Exonic
960096660 3:113696380-113696402 CGCGGTCTCGGCCGCGGTGGCGG + Exonic
961540809 3:127598210-127598232 TGCGCTCGCCTGCGCTGTGGTGG - Exonic
963804962 3:149714024-149714046 CGCTCTGGCAGCCGCCGTGATGG + Intronic
963904466 3:150762682-150762704 CGAGATCACCGCCGCCGCGGCGG + Exonic
966390870 3:179451330-179451352 CGAGCTCGCCGCCTACCTGGAGG + Exonic
968703764 4:2068967-2068989 CTCGCTCGCCCCCACCCTGGGGG - Exonic
970332789 4:15002874-15002896 TGCCCGCGCCGCCGCCGAGGGGG - Exonic
971308591 4:25505216-25505238 CACGCTCACCGCCGCGGTGCTGG + Intergenic
981315475 4:143336458-143336480 CGCTCTCGCGGCCGCCGAAGAGG - Intergenic
983923432 4:173371257-173371279 CGCGGCCGCCGCCGCCTCGGCGG + Exonic
985006006 4:185535662-185535684 CGCGCCCGCCGCGGCCCGGGAGG - Intergenic
985660839 5:1155872-1155894 CCCGCTCCCCGCAGCCGTCGCGG - Intergenic
985988346 5:3535871-3535893 CCCGCAGGCGGCCGCCGTGGAGG - Intergenic
990954635 5:61330885-61330907 CGCGCTCTCAGTCGCCTTGGCGG - Intergenic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992487696 5:77211275-77211297 CGCGCTGGCACACGCCGTGGGGG + Intronic
997980831 5:138466460-138466482 CGCACTAGCCGCGGCCATGGGGG + Intronic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1007614449 6:43171878-43171900 CGCCCTCGCTGCCGCTGTAGAGG - Exonic
1007689208 6:43687828-43687850 AGCGCCCGCCGCCGCAGTGGTGG + Intergenic
1010083050 6:71886579-71886601 GGCGGCCGCTGCCGCCGTGGAGG - Intergenic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1016923478 6:149317903-149317925 GGCGCTGGCGGCGGCCGTGGTGG + Intronic
1018156723 6:160991979-160992001 CACGCCTGCCGCCGCCATGGAGG + Exonic
1019279506 7:192863-192885 GGCGCTCGCAGCCGCCGGCGCGG - Intergenic
1019279644 7:193343-193365 CGCGCAGCCCGCCGCCGAGGTGG + Exonic
1023842392 7:44104650-44104672 CGCGCGTGCCGCGGCCATGGCGG + Exonic
1024520969 7:50304123-50304145 CGCACCCGCCGCCGCCCCGGCGG + Intronic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1026822274 7:73557572-73557594 CGCTCCCGCCGCCGCCATGTCGG - Exonic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1029927084 7:104329232-104329254 CGCGCTCACCTCCGCGGAGGCGG + Intronic
1031317371 7:120273813-120273835 GGCAGCCGCCGCCGCCGTGGCGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1032344357 7:131105940-131105962 CGCGCCCGCCGCCGCCCGGCCGG - Intergenic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1044549461 8:93495924-93495946 CGCGCTCGCCCCCGCTCTGCCGG + Intergenic
1048009387 8:130443719-130443741 CGCGCCCTCCGCCGCCGAGCGGG - Intergenic
1049784657 8:144444574-144444596 CGCGCCCGCCGCCGCCGTCGAGG - Intergenic
1049799117 8:144509618-144509640 CGGGCTGCCCGCCGCTGTGGCGG + Exonic
1050472543 9:6008037-6008059 TGCGCGCGCCGCCGCCGGGGGGG - Intergenic
1052888839 9:33677021-33677043 CGCCGCCGCCGCCGCCGTGTTGG + Intergenic
1054808052 9:69412123-69412145 GGCGCTCGCTGCTCCCGTGGCGG + Intergenic
1057466313 9:95317448-95317470 CGCTCTCGCCGCTGACGTGTCGG + Intronic
1059145546 9:111896672-111896694 CGCTCTCGCCGGCGCCGCAGCGG + Intergenic
1062629972 9:137459145-137459167 CGCGCCCGCCGCCTCCGCCGGGG + Exonic
1062656338 9:137605970-137605992 CGGGCTCGGCGGCGCCGGGGAGG + Intronic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203469926 Un_GL000220v1:111815-111837 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477747 Un_GL000220v1:155787-155809 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1189310656 X:40015043-40015065 CGCGCTCCTCGTCGCCGCGGGGG + Intergenic
1195716872 X:107826441-107826463 CCCCCTCGCCGCGGCCCTGGAGG + Intronic
1196684169 X:118496267-118496289 GGCGCACGCCTCCGCCGTGCCGG - Intronic
1198767086 X:140091321-140091343 CTCGGTCGCCGCCGCCGCTGCGG - Intergenic
1200244624 X:154516334-154516356 CGCGCTGGCCGCCGCATGGGAGG + Intergenic