ID: 1028417585

View in Genome Browser
Species Human (GRCh38)
Location 7:90596369-90596391
Sequence GGCCGCGCTCGCCGCCGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 422}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028417585_1028417602 30 Left 1028417585 7:90596369-90596391 CCACGGCGGCGGCGAGCGCGGCC 0: 1
1: 0
2: 6
3: 109
4: 422
Right 1028417602 7:90596422-90596444 CGCCCAGCTGCGGCCCAGGCCGG No data
1028417585_1028417594 20 Left 1028417585 7:90596369-90596391 CCACGGCGGCGGCGAGCGCGGCC 0: 1
1: 0
2: 6
3: 109
4: 422
Right 1028417594 7:90596412-90596434 CGCCCCCGCCCGCCCAGCTGCGG 0: 1
1: 2
2: 4
3: 39
4: 387
1028417585_1028417599 26 Left 1028417585 7:90596369-90596391 CCACGGCGGCGGCGAGCGCGGCC 0: 1
1: 0
2: 6
3: 109
4: 422
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028417585 Original CRISPR GGCCGCGCTCGCCGCCGCCG TGG (reversed) Intronic