ID: 1028417599

View in Genome Browser
Species Human (GRCh38)
Location 7:90596418-90596440
Sequence CGCCCGCCCAGCTGCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028417590_1028417599 0 Left 1028417590 7:90596395-90596417 CCCGGCACCACGTAAACCGCCCC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417589_1028417599 1 Left 1028417589 7:90596394-90596416 CCCCGGCACCACGTAAACCGCCC No data
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417585_1028417599 26 Left 1028417585 7:90596369-90596391 CCACGGCGGCGGCGAGCGCGGCC 0: 1
1: 0
2: 6
3: 109
4: 422
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417587_1028417599 5 Left 1028417587 7:90596390-90596412 CCGCCCCCGGCACCACGTAAACC 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417591_1028417599 -1 Left 1028417591 7:90596396-90596418 CCGGCACCACGTAAACCGCCCCC 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417583_1028417599 29 Left 1028417583 7:90596366-90596388 CCACCACGGCGGCGGCGAGCGCG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417592_1028417599 -7 Left 1028417592 7:90596402-90596424 CCACGTAAACCGCCCCCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345
1028417588_1028417599 2 Left 1028417588 7:90596393-90596415 CCCCCGGCACCACGTAAACCGCC 0: 1
1: 0
2: 1
3: 4
4: 35
Right 1028417599 7:90596418-90596440 CGCCCGCCCAGCTGCGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028417599 Original CRISPR CGCCCGCCCAGCTGCGGCCC AGG Intronic