ID: 1028418828

View in Genome Browser
Species Human (GRCh38)
Location 7:90609945-90609967
Sequence AAACCAAATAAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028418828_1028418833 1 Left 1028418828 7:90609945-90609967 CCTGCTTTACCCTTATTTGGTTT 0: 1
1: 0
2: 2
3: 16
4: 265
Right 1028418833 7:90609969-90609991 TGCAGGAACTGCATCTTACTGGG 0: 1
1: 0
2: 0
3: 14
4: 135
1028418828_1028418832 0 Left 1028418828 7:90609945-90609967 CCTGCTTTACCCTTATTTGGTTT 0: 1
1: 0
2: 2
3: 16
4: 265
Right 1028418832 7:90609968-90609990 CTGCAGGAACTGCATCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028418828 Original CRISPR AAACCAAATAAGGGTAAAGC AGG (reversed) Intronic
900169847 1:1261592-1261614 AAACAAAAAAAATGTAAAGCTGG + Intronic
902268604 1:15287136-15287158 AAACCAAAGAATGGAAAAGAGGG + Intronic
904929950 1:34078978-34079000 AAAGCAATGAAGGGTAAAGATGG - Intronic
906047784 1:42846127-42846149 AAATCAAAGGAGGGTAGAGCTGG - Intergenic
907001894 1:50868438-50868460 AAGCCAAATAAGTGGAAAGAAGG - Intronic
907446629 1:54512307-54512329 CAACCAAGTAAGGATATAGCAGG - Intergenic
907534591 1:55138379-55138401 AGAACAAATAAGAGTAAAGCAGG - Intronic
910055489 1:83028848-83028870 AAACAAACTAAGGGTAAATGTGG + Intergenic
911710957 1:101072474-101072496 AAAGGTAATAATGGTAAAGCAGG - Intergenic
912045471 1:105448749-105448771 AGACCAGAAAAGGGTGAAGCAGG + Intergenic
912163815 1:107018824-107018846 AAACCAAAAAACTGTAAACCTGG - Intergenic
912644383 1:111378238-111378260 AAATCACATCAGGGTAAATCAGG - Intergenic
915911098 1:159916075-159916097 AAAGCAATTAAGGGAGAAGCAGG - Intergenic
916350260 1:163841642-163841664 AAACAAAACAAGGGTAAAGGAGG - Intergenic
916461902 1:165033930-165033952 ACACCAGAGAGGGGTAAAGCAGG + Intergenic
918146926 1:181765212-181765234 ACACAAAATAAGGGAAAAGAGGG - Intronic
920356398 1:205376409-205376431 AGTCCAAATAAGGGAAAAGTGGG - Intergenic
921787010 1:219243443-219243465 AAACAAAATAAAGGAAGAGCAGG + Intergenic
922024537 1:221738421-221738443 AAACCACATAAAAGTCAAGCTGG + Intronic
923915533 1:238499652-238499674 AACCCAAATAAGGGAACAACAGG + Intergenic
1063594456 10:7421222-7421244 AAAACTAATAATGGCAAAGCTGG - Intergenic
1065395543 10:25232935-25232957 GAAACAAATAAGAGTAAGGCTGG + Intronic
1067958492 10:50820340-50820362 AAAACAAATAGAGGTAAAGTTGG + Intronic
1068250936 10:54439272-54439294 AAACCAAATATGCATAAATCTGG + Intronic
1068416971 10:56735372-56735394 AAACAAAAGAAGGGTAAAGCAGG - Intergenic
1068610558 10:59055669-59055691 AAACAAAATAAGTGTAAATTTGG + Intergenic
1068791329 10:61034285-61034307 AATACAAATTAGGCTAAAGCAGG - Intergenic
1068792107 10:61039750-61039772 AATACAAATTAGGCTAAAGCAGG - Intergenic
1069403411 10:68074454-68074476 AAACAAAATAAGAGTAATACAGG + Intronic
1070764062 10:79046444-79046466 AAAAAAAAAAAGAGTAAAGCTGG + Intergenic
1072471410 10:95717521-95717543 AATACAAATTAGGCTAAAGCAGG - Intronic
1072601474 10:96934909-96934931 AAACTAAATAGGAGTAAAGTTGG - Intronic
1075692091 10:124403859-124403881 GAACCAATTCAGGGTGAAGCAGG - Exonic
1077318936 11:1932296-1932318 AAACCTCATAAGAATAAAGCTGG + Intronic
1077767438 11:5175652-5175674 AAACCAAACAATTTTAAAGCAGG - Intronic
1078302198 11:10143454-10143476 AAATCAAAGAAAGGTACAGCAGG + Intronic
1078684845 11:13519560-13519582 AAAAAACATAAGGATAAAGCAGG + Intergenic
1079413982 11:20215769-20215791 AAACCATATAAGAGAAAAGGTGG + Intergenic
1079421283 11:20291651-20291673 AAACAAAATAATGGTGAAGGAGG + Intergenic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1081043787 11:38246125-38246147 AAAACAATAAAGGCTAAAGCAGG + Intergenic
1081170135 11:39858206-39858228 AAACCAAATAAAGCTAAAGAAGG - Intergenic
1081359604 11:42158862-42158884 AAACCAAAAGAGAGGAAAGCTGG + Intergenic
1081517959 11:43851943-43851965 TAAACAAATAAGGGAACAGCAGG - Intronic
1082208779 11:49471130-49471152 AAACCAAATAAGGGAAAAAAAGG - Intergenic
1082218477 11:49603455-49603477 AAACCAGATAAGCATGAAGCTGG + Intergenic
1082829182 11:57602791-57602813 AAAACAAAGAAGGAGAAAGCCGG + Intronic
1084070688 11:66732235-66732257 AAACCAGGCAAGGGTAGAGCTGG + Intergenic
1086748662 11:90462499-90462521 AACCCAAATAAGGGTGAAAGGGG + Intergenic
1087117580 11:94541985-94542007 ACATCAAATAAGGGTATAGTAGG + Intergenic
1087195940 11:95304417-95304439 AAACTAAGTAAGGTTAAAGGTGG - Intergenic
1088402651 11:109438197-109438219 AAATCAAATAAGGCTTAAGAAGG + Intergenic
1089476962 11:118772058-118772080 AAACTTCATAAGGTTAAAGCAGG + Intronic
1090878457 11:130812571-130812593 AAGCCAAATAGGGGTCAAGGAGG + Intergenic
1091914354 12:4258167-4258189 AAAGCAAATAAGTTTAAAGATGG - Intergenic
1092468957 12:8761577-8761599 AAGACAAATTAGGCTAAAGCAGG - Intronic
1093062212 12:14618824-14618846 AAACCAAATAAGAGGGAAACAGG + Intronic
1094153407 12:27311780-27311802 ACACCAAATAATGATCAAGCTGG + Intronic
1095225624 12:39673569-39673591 AAACAGAAGAGGGGTAAAGCTGG - Intronic
1095701418 12:45194633-45194655 AAACCAAATTAGGCTAAACATGG + Intergenic
1096483002 12:51955067-51955089 AAACCAATAAAGCCTAAAGCAGG - Intronic
1096601514 12:52733096-52733118 AAAGCAAAGAAGGGCAGAGCTGG - Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1098621701 12:72608888-72608910 ATTGCAAATAAGGGTAGAGCTGG - Intronic
1099605687 12:84798490-84798512 AATACAAATTAGGCTAAAGCAGG + Intergenic
1102319322 12:111917801-111917823 AAAACAAATAAGAAGAAAGCAGG - Intergenic
1102423951 12:112825841-112825863 AAACTAAATCAGAGTAAAGGAGG + Intronic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1103220119 12:119237187-119237209 AAACCACAGAAGGCCAAAGCTGG + Intergenic
1107137379 13:36958796-36958818 AATACAAATTAGGCTAAAGCAGG + Intronic
1115183557 14:30657348-30657370 AAACCAAACAAGGATAATACTGG + Intronic
1115728798 14:36245571-36245593 AAAACTAAGAAGGGGAAAGCCGG + Intergenic
1118226946 14:63910088-63910110 AAAAGAAATAAGGCTATAGCAGG + Intronic
1118551918 14:66961576-66961598 CAACCAAATAAGGGAAAAAATGG + Intronic
1119505006 14:75164978-75165000 AAACCACATACAGGAAAAGCTGG - Intronic
1119656116 14:76418335-76418357 AAACCAGATAAGGGTTATACAGG - Intronic
1120217823 14:81699484-81699506 TAACCAAATAAGGGAACAGAAGG - Intergenic
1120383402 14:83811935-83811957 AAAGCATATATGTGTAAAGCTGG + Intergenic
1120611491 14:86646696-86646718 ACACCAAACAAGGGAAATGCAGG + Intergenic
1120749276 14:88182902-88182924 AAACCAAATAAATGTACAGTAGG + Intronic
1121298646 14:92851168-92851190 AAACAAAATAAGGGTGCTGCCGG + Intergenic
1122049134 14:99043202-99043224 AAACCACATAAGAGAAAAGGAGG + Intergenic
1122559070 14:102598292-102598314 AAACCTAAATAGGGTCAAGCTGG - Intronic
1125390686 15:39189606-39189628 AAACCACATAAGTGTATAGGTGG + Intergenic
1126432889 15:48605193-48605215 AAACAAAAAAAGGATAAAGTGGG + Intronic
1126900320 15:53308031-53308053 AACCCAAAAAAGGGGAAACCAGG + Intergenic
1129347742 15:74934652-74934674 AATCCAATAATGGGTAAAGCAGG + Intronic
1130527287 15:84717984-84718006 AAACAAAAAAAGGTTAAAGATGG + Intergenic
1134048441 16:11119383-11119405 AAACAAAAAAAGAGCAAAGCTGG - Intronic
1136462768 16:30422083-30422105 AACCCACATATGGGAAAAGCTGG + Intronic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1141298422 16:82791362-82791384 AATACAAATTAGGCTAAAGCAGG + Intronic
1144841158 17:18186826-18186848 AAAGCAAATGAGAGAAAAGCTGG - Intronic
1149072628 17:52560817-52560839 AAACAATATGGGGGTAAAGCAGG - Intergenic
1150258169 17:63766281-63766303 GTACCAAATAAGAGAAAAGCAGG - Intronic
1151501527 17:74493004-74493026 AAAAAAAAAAAGGGTAAATCTGG - Intergenic
1155046865 18:22110422-22110444 AAACAAAATAAAGGCAAAGGTGG + Intergenic
1155545181 18:26907321-26907343 CCACCAAATAAGGAGAAAGCAGG + Exonic
1155817564 18:30333023-30333045 AAACCAAATAAGGGTAATTTTGG + Intergenic
1155900551 18:31383880-31383902 AAAACAAATAATTGAAAAGCAGG - Intronic
1156092177 18:33485278-33485300 AAAAAAAATAAGGATAAAGCAGG - Intergenic
1157704603 18:49793331-49793353 AAACCAAATAAGGGCATATAAGG - Intronic
1161689374 19:5722112-5722134 AAATAAAATAAGGGTATGGCTGG - Intronic
1162702810 19:12530744-12530766 AAATAAAATAAGGGGAAAGATGG + Intronic
1164421120 19:28093794-28093816 AACCCAAATAAGGGAAAATAGGG + Intergenic
1164548777 19:29190627-29190649 AAGCCAACTAAGGGAGAAGCTGG - Intergenic
1168501721 19:56898759-56898781 AAACCACATCAGAGGAAAGCAGG - Intergenic
926277216 2:11413459-11413481 AAAAAAAAAAAGAGTAAAGCAGG + Intergenic
928114536 2:28537670-28537692 AAAAAAAAAAAAGGTAAAGCAGG + Intronic
929087458 2:38182532-38182554 ACATCAAATAAGGGTAAAATTGG + Intergenic
931083984 2:58808327-58808349 AACCCAAAGAAGGGTTAAGTGGG - Intergenic
931118715 2:59192918-59192940 AAACAAAATAAAGGTAAAAGTGG + Intergenic
931118756 2:59193196-59193218 AAACAAAATAAAGGTAAAAGTGG + Intergenic
932513180 2:72316429-72316451 AAACCAAATATGGGTAAAGTGGG - Intronic
932865785 2:75340343-75340365 AAAACAGATAAGGATGAAGCAGG - Intergenic
934624957 2:95838815-95838837 AAACCAAATAAGGTGAATCCAGG - Intronic
934808621 2:97262498-97262520 AAACCAAATAAGGTGAATCCAGG + Intronic
934828890 2:97494693-97494715 AAACCAAATAAGGTGAATCCAGG - Intronic
937054240 2:118918168-118918190 AACCCAAATCAGGATATAGCTGG + Intergenic
938247400 2:129789403-129789425 AAACAAAAAAAGGGCAAAGCAGG - Intergenic
938844924 2:135198346-135198368 AGACCAAATTAGGGGAAGGCAGG + Intronic
939903243 2:147877091-147877113 AAACTAAATAAGGCCACAGCTGG - Intronic
940214483 2:151290076-151290098 AAACCAAATAAAGTCAAAGCAGG + Intergenic
942181606 2:173385833-173385855 AAACCAAAAAAAGGAAAAGCAGG + Intergenic
942580162 2:177409409-177409431 AATACAAATTAGGCTAAAGCAGG - Intronic
943089548 2:183357718-183357740 CATCCATATAAGGGTGAAGCTGG + Intergenic
943488845 2:188523622-188523644 AAACCAAATAAAGTTAGAGAAGG - Intronic
944070200 2:195658582-195658604 AAAGCAAGTAATGGAAAAGCTGG + Intronic
1169745597 20:8939356-8939378 AAACCATATCAGGGTAAATCAGG + Intronic
1170900977 20:20462794-20462816 AAGCCAAAGAAGGACAAAGCAGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174379034 20:50144835-50144857 AAAGGAAATAAGGGAAAAGCCGG - Intronic
1175062431 20:56255896-56255918 GAACAAAATGAGGGTAATGCAGG - Intergenic
1175452814 20:59084396-59084418 AAAGCAAATAATGGTACAGATGG + Intergenic
1177444758 21:21179236-21179258 AAAAAAAATCAGGATAAAGCTGG - Intronic
1177629877 21:23712599-23712621 AAGCCAAATCAGGAAAAAGCTGG + Intergenic
1178487634 21:33028904-33028926 AAACCAAAATAGAGGAAAGCCGG - Exonic
1182203002 22:28592495-28592517 AAAAAAAATAAAGGTAAAGTGGG + Intronic
1182914601 22:34017827-34017849 AAACTAAAAAGAGGTAAAGCTGG - Intergenic
1183651213 22:39154365-39154387 AACCCAAACAACTGTAAAGCAGG + Intergenic
949122105 3:398763-398785 AAACCAAAGAAGGATAATGAAGG - Intronic
950421477 3:12902110-12902132 AAACCAAACAAGGAAAAAGAAGG + Intronic
950824347 3:15801221-15801243 GAATCACATAATGGTAAAGCTGG + Intronic
951219458 3:20054092-20054114 AAAAAAAATAAGTCTAAAGCCGG - Intronic
951713618 3:25612639-25612661 AAAGCAATTAAAGGTAAAGTTGG - Exonic
952807352 3:37368979-37369001 GAACAAAAAAAAGGTAAAGCGGG - Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
958984011 3:100759458-100759480 AGACAAAATAAGGCTAAATCAGG + Intronic
960841906 3:121967642-121967664 AAATCAAATTAGGGTAAATATGG - Intergenic
961229334 3:125288213-125288235 TAAACAGATAAGCGTAAAGCAGG - Exonic
963819621 3:149874577-149874599 AAATAGAATAAGGGTAAAGATGG + Intronic
963873353 3:150444199-150444221 AAACTAATTAAGGGTATCGCTGG - Intronic
963935298 3:151046177-151046199 ACACCAAATATGGGTAATGCAGG + Intergenic
964440628 3:156705071-156705093 TAACAAAATAAGGGTAACTCTGG - Exonic
964919907 3:161884131-161884153 ACACCATATATGGCTAAAGCAGG - Intergenic
965449971 3:168825694-168825716 CAACCAGAAAAGGGTACAGCGGG - Intergenic
965453130 3:168863006-168863028 AAACAAGAAAGGGGTAAAGCAGG - Intergenic
966062841 3:175780567-175780589 AAACCACAGGAGGGCAAAGCTGG + Intronic
966869679 3:184282113-184282135 AAAAAAACTAAGAGTAAAGCAGG + Intronic
968340044 3:197947918-197947940 AAAAAAAAAAAAGGTAAAGCAGG - Intronic
970439221 4:16065761-16065783 AAACTAAATAAGAATATAGCAGG + Intronic
971821425 4:31560718-31560740 AACCCAAAGAAGTGTAAGGCTGG - Intergenic
973620321 4:52720018-52720040 AAACCAAAATAGGGCTAAGCAGG - Intergenic
973916944 4:55643428-55643450 TAACCATATCAGGGTAAAGGCGG + Intergenic
974413600 4:61575117-61575139 AAACCAAAAAAGAGTAAATGAGG - Intronic
974841765 4:67307337-67307359 AATACAAATTAGGCTAAAGCAGG + Intergenic
975139498 4:70904766-70904788 AAAAAAAAAAAGGTTAAAGCAGG + Intronic
975489491 4:74973152-74973174 AAACCAAAAAATGTTAAAGAAGG - Intronic
975940522 4:79639091-79639113 AAAGTAAAGCAGGGTAAAGCGGG - Intergenic
976605130 4:86975553-86975575 AAACCAAATAAAGATTAAGGTGG - Intronic
977556146 4:98489343-98489365 AATACAAATTAGGCTAAAGCAGG + Intronic
977921946 4:102655127-102655149 AAACCAAAGAAGCGTAAGACTGG + Intronic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
979092534 4:116503748-116503770 AAACCAAATATGGCTAAATATGG - Intergenic
980444707 4:132888956-132888978 AATACAAATTAGGCTAAAGCAGG + Intergenic
980556676 4:134415635-134415657 AGTCCAAATCAGAGTAAAGCAGG - Intergenic
980873224 4:138633730-138633752 AAACCAAATCAAAGAAAAGCTGG - Intergenic
983506067 4:168555295-168555317 AAACCAAAGAAGACTAAAACTGG + Intronic
983911125 4:173240785-173240807 AAGCCAAACAAGGGTTAAACAGG - Intronic
984020207 4:174475819-174475841 AAACCAGCTATGGCTAAAGCAGG - Intergenic
984146668 4:176070094-176070116 AAAATTAATAAGGGAAAAGCTGG + Intronic
984340355 4:178449499-178449521 AAAAAAAAAAAAGGTAAAGCTGG - Intergenic
984796415 4:183664302-183664324 AAAACAAAAAAGGGAAAACCTGG - Intronic
987569730 5:19640801-19640823 AAACCAACTAAGCCTAAAGTTGG + Intronic
987942895 5:24565059-24565081 GAACTAAATTAGGGTAAAGGAGG - Intronic
989025538 5:37062931-37062953 AAAAAAAAAAAGGGTTAAGCTGG + Intronic
990752179 5:59028742-59028764 AATCCAACTGAGGGTAAAGAAGG + Intronic
990891775 5:60658637-60658659 AATACAAATTAGGCTAAAGCAGG + Intronic
990892773 5:60665844-60665866 AATACAAATTAGGCTAAAGCAGG + Intronic
992055235 5:72982365-72982387 AAACCCAATAAGGGGGCAGCTGG - Intronic
992481145 5:77153561-77153583 AAAAAAAAAAAGAGTAAAGCTGG - Intergenic
994741418 5:103624351-103624373 AAAACAAACAACTGTAAAGCTGG + Intergenic
995364312 5:111338903-111338925 AAAGCAAAAAAGAATAAAGCCGG - Intronic
995785106 5:115819323-115819345 AATACAAATTAGGCTAAAGCAGG - Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
1000481340 5:161779042-161779064 AAATCAAATCAGGGTGAAGTGGG - Intergenic
1000783208 5:165510756-165510778 AAATCAAATAAGGGAAAGACAGG + Intergenic
1001785916 5:174413005-174413027 AAACCAATTTGGGGGAAAGCCGG + Intergenic
1002757883 6:179026-179048 GGGCCAAATAAGGGAAAAGCTGG - Intergenic
1004001414 6:11600339-11600361 AAGACCAAAAAGGGTAAAGCAGG + Intergenic
1005750985 6:28882599-28882621 CAACTAATAAAGGGTAAAGCTGG + Intergenic
1008673036 6:53793433-53793455 AAACAAAAGAAGGGTGAAGTGGG + Intergenic
1009408953 6:63343465-63343487 GAAGCAACTAAGGGTAGAGCAGG - Intergenic
1009656616 6:66554752-66554774 ACACCCAATTATGGTAAAGCTGG - Intergenic
1009896002 6:69750427-69750449 AAAGCAAATAAAGACAAAGCTGG + Intronic
1010059614 6:71607358-71607380 AAACCATATAATGGTTAAACAGG - Intergenic
1010471285 6:76231268-76231290 AAATCAAATAAAGGGAAATCAGG - Intergenic
1011248232 6:85342198-85342220 TAATCATATCAGGGTAAAGCAGG + Intergenic
1011793225 6:90922536-90922558 AAACCAAATGAGGGAAAGCCAGG + Intergenic
1012012488 6:93806912-93806934 AAACAAAATAAGGTTTCAGCTGG - Intergenic
1012633421 6:101503050-101503072 TAACCAAATAGGGGAAAACCAGG + Intronic
1015594842 6:134856602-134856624 AGACTAAATAATGTTAAAGCTGG + Intergenic
1015594913 6:134857415-134857437 AGACTAAATAATGTTAAAGCTGG + Intergenic
1015728299 6:136322211-136322233 GATCCAAATGAGGCTAAAGCTGG - Intergenic
1018634220 6:165846725-165846747 AAACCAAATAAAAGCAAAACTGG + Intronic
1018734630 6:166678346-166678368 GAACCAAATCATGGGAAAGCTGG + Intronic
1019456667 7:1131205-1131227 AAAAAAAAAAAGAGTAAAGCAGG + Intronic
1020048113 7:5058807-5058829 AAACCAAAAAAGTGGAAAACAGG - Intronic
1021062176 7:16127221-16127243 AAACTAAATAAAGGAAAAGAGGG + Intronic
1021576661 7:22111608-22111630 AGACCAAATAGGGGCAAAGGTGG - Intergenic
1022255775 7:28656116-28656138 AGTCCACATAGGGGTAAAGCTGG - Intronic
1022883983 7:34622611-34622633 AGACCAAATAAGGGTAGAATAGG + Intergenic
1023211848 7:37814353-37814375 AAACCCAATAAAGGTATTGCTGG - Intronic
1024325561 7:48106812-48106834 AAACAAAATAAAATTAAAGCAGG - Intronic
1026346935 7:69482572-69482594 AATACAAATTAGGCTAAAGCAGG + Intergenic
1026977113 7:74505623-74505645 AAATCGAATCAGGGCAAAGCAGG - Intronic
1027428263 7:78083455-78083477 AAACCAGATAAAGGTAATTCAGG + Intronic
1027725712 7:81803140-81803162 AAACCAATTAAAGATAAAGATGG + Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1028608858 7:92685684-92685706 AAACCAAAACTGGGTAAATCAGG + Intronic
1028926186 7:96358957-96358979 AATACAAATTAGGCTAAAGCAGG - Intergenic
1030004920 7:105108395-105108417 CAACCAAATAATGGGAAATCAGG - Intronic
1030473789 7:110002069-110002091 AAACCAAATAAAGGCAAACTGGG - Intergenic
1031122422 7:117737373-117737395 AACACAAATCAGGGAAAAGCTGG - Intronic
1031250907 7:119379189-119379211 AATACAAATTAGGCTAAAGCAGG - Intergenic
1031351127 7:120732210-120732232 AAATCAGATAAGGGGAAAGGAGG + Intronic
1034707112 7:153155450-153155472 AATACAAATTAGGCTAAAGCAGG - Intergenic
1037029457 8:14085404-14085426 AAACCAAACAGGGTTAAAGATGG - Intergenic
1039071615 8:33653997-33654019 AAAACAAAGAATCGTAAAGCTGG - Intergenic
1039155732 8:34554489-34554511 AAACCACATATGGGTAAGACTGG - Intergenic
1039196908 8:35042605-35042627 ATATCACAGAAGGGTAAAGCTGG + Intergenic
1039701820 8:39969938-39969960 AAACCAGATAGGCTTAAAGCTGG + Intronic
1039709222 8:40039133-40039155 AAACCAAGTGAGAGTAGAGCTGG + Intergenic
1042056379 8:64768177-64768199 AATACAAATTAGGCTAAAGCAGG + Intronic
1042153082 8:65810995-65811017 CAACCAAATAAAAGTAAATCTGG + Intronic
1042292892 8:67188419-67188441 AATACAAATTAGGCTAAAGCAGG + Intronic
1042662848 8:71174755-71174777 TAACCAAAAAAGGGATAAGCAGG - Intergenic
1044544044 8:93439231-93439253 AAAGAAAATAAGCATAAAGCAGG + Intergenic
1046319500 8:112553733-112553755 AGACCAAAGAAGGTCAAAGCAGG + Intronic
1046388664 8:113538647-113538669 ATACTAAATAAGAATAAAGCTGG - Intergenic
1046546395 8:115655948-115655970 GAACCAAACAAGGGGATAGCTGG + Intronic
1049581813 8:143415546-143415568 AAACCAAACAAAGGAAAACCAGG + Intergenic
1051297733 9:15614670-15614692 AAATCAAATAATGTTAAAGGGGG - Intronic
1052714058 9:32093543-32093565 AAACCAAATAAAGGATAATCTGG - Intergenic
1053011964 9:34638598-34638620 TAGCCAAATAAGGGGAAAGTGGG - Intronic
1053491685 9:38510853-38510875 AAAACAAATAAGAATAAAGGAGG + Intergenic
1053551084 9:39079970-39079992 AAACCAAAGAAGAGTAAAAAGGG - Intronic
1053815194 9:41900051-41900073 AAACCAAAGAAGAGTAAAAAGGG - Intronic
1054615402 9:67287390-67287412 AAACCAAAGAAGAGTAAAAAGGG + Intergenic
1055124680 9:72705475-72705497 AAATCAAATCAGGGCAAAGGAGG + Intronic
1056295051 9:85184464-85184486 AATCCAAATAAGGATAAAGGAGG - Intergenic
1057495577 9:95558129-95558151 AAACAAAGTGAGGGTGAAGCTGG - Intergenic
1057722703 9:97545722-97545744 AAGCCAAAAGAGGGTTAAGCTGG - Intronic
1058020480 9:100081246-100081268 AATGCAAATAATGGAAAAGCTGG + Intronic
1058150490 9:101458546-101458568 AGACAAACTAAGGCTAAAGCTGG + Intergenic
1059170619 9:112121213-112121235 AAAACAAAGAAGGGTAGAGCTGG - Intronic
1060366509 9:123021307-123021329 AAACCTTATAAGGGAAGAGCAGG + Intronic
1061099093 9:128478632-128478654 AAACCAAAAAAGGAGAAAACTGG - Intronic
1186030830 X:5367322-5367344 AAATTAAACAAGGATAAAGCTGG - Intergenic
1187750811 X:22462811-22462833 AAAACAAATAAAGGTAATGCAGG - Intergenic
1188285547 X:28322251-28322273 AATACAAATTAGGCTAAAGCAGG + Intergenic
1188365528 X:29310146-29310168 AAACAAAAAAAGGGTAAGTCGGG + Intronic
1189028229 X:37421636-37421658 AAACAAAATAAGGGAGAAGGTGG - Intronic
1189699104 X:43697829-43697851 AAACTATATTAGGGAAAAGCAGG + Intronic
1190211006 X:48447840-48447862 GAACCAATTCAGGGTGAAGCAGG - Intergenic
1190367200 X:49706896-49706918 AAATCATGTAAGGGTATAGCTGG + Intergenic
1193298778 X:79864384-79864406 AAACCAAAGAAAGGGAAAACAGG - Intergenic
1194004153 X:88469783-88469805 AAAACAAATCATGGTAAAACCGG - Intergenic
1194031572 X:88823181-88823203 AAACCTAATAAGGCTAAAAGTGG - Intergenic
1196017614 X:110956477-110956499 AACCCAAACAAGGGTAAATGAGG - Intronic
1196193032 X:112813872-112813894 ATACAAAATCAGGGAAAAGCCGG + Intronic
1197616019 X:128692392-128692414 AAAACATATAAGGAAAAAGCTGG - Intergenic
1197954107 X:131928564-131928586 AAATCACATAAGGGTAAATGGGG + Intergenic
1200131622 X:153851521-153851543 AACTCAAATAAGGGAAAAGGTGG - Intergenic