ID: 1028422396

View in Genome Browser
Species Human (GRCh38)
Location 7:90648454-90648476
Sequence TCCACACAGGTCAGTCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028422394_1028422396 -5 Left 1028422394 7:90648436-90648458 CCTATTGCAGGTGCAGTATCCAC 0: 1
1: 0
2: 3
3: 8
4: 105
Right 1028422396 7:90648454-90648476 TCCACACAGGTCAGTCCTATTGG 0: 1
1: 0
2: 0
3: 6
4: 85
1028422392_1028422396 29 Left 1028422392 7:90648402-90648424 CCTCAGAAGTCACACATTGTCAT 0: 2
1: 3
2: 26
3: 103
4: 423
Right 1028422396 7:90648454-90648476 TCCACACAGGTCAGTCCTATTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028422396 Original CRISPR TCCACACAGGTCAGTCCTAT TGG Intronic
900358739 1:2277705-2277727 CACACACACGTCAGTCCTGTGGG + Intronic
901038726 1:6351569-6351591 TCCACACAGGCCTGTCCTGGGGG + Intronic
919856442 1:201709490-201709512 TGTACACAGGTAAGTCCTCTTGG + Intronic
1063759207 10:9053151-9053173 ACCATACACATCAGTCCTATGGG + Intergenic
1065274644 10:24073685-24073707 TCCACACAGCACATTCCTATTGG - Intronic
1065470026 10:26068876-26068898 TCCACAAAGGTATGTCGTATGGG + Exonic
1073309809 10:102532318-102532340 CCCACACAGGCCAGCCCTCTAGG + Intronic
1074901538 10:117820223-117820245 TCCACAGAGGTGTGTTCTATTGG + Intergenic
1075850902 10:125585962-125585984 ACCACACAACCCAGTCCTATGGG - Intronic
1078064594 11:8069795-8069817 TCCACACAGGTCAGCTGAATTGG + Intronic
1082998903 11:59274135-59274157 CCCACAAAGGACAGTCCTAGTGG + Intergenic
1084910168 11:72381744-72381766 TCCACACAGCTCAGAGCTTTAGG + Intronic
1088803489 11:113329413-113329435 TCCACACAGGTCAGCCCTCCAGG - Intronic
1089013701 11:115149731-115149753 TGCACACAGTCCAGTCCTCTGGG + Intergenic
1090972134 11:131653105-131653127 TCCACACAGGGCACACCCATGGG - Intronic
1092131659 12:6117345-6117367 TCCACACAGGTTTGTGCTAGAGG - Intronic
1098298945 12:69034014-69034036 TCCAAACAGGAAAGTCCTCTGGG - Intergenic
1102380934 12:112466359-112466381 TGCACACAGGCCAGTACAATTGG + Intronic
1104318863 12:127731218-127731240 TCCACACACCTCATACCTATTGG + Intergenic
1106287935 13:28334467-28334489 TCCACACAGGGAAGTCTTCTTGG - Intronic
1107811849 13:44208045-44208067 TCCACACAAGGGAGTCATATTGG - Intergenic
1108864041 13:54900166-54900188 TCCACACAGGTCAGCCATCGGGG - Intergenic
1112300481 13:98225348-98225370 TCCAAGCAGCTCAGTCCTGTGGG - Intronic
1113869792 13:113552181-113552203 ACCACCCAGGTCAGTGCTCTGGG - Intronic
1117832962 14:59771352-59771374 TGCACACAGTTCAGACTTATGGG - Intronic
1127818801 15:62637390-62637412 TCCATACATTTCAGTCCTCTTGG - Exonic
1129190008 15:73931639-73931661 TCCAGACAGGTCTGGCCTCTTGG - Intronic
1131784387 15:95896169-95896191 ACCACTCAGCTCAGTCCTTTGGG - Intergenic
1132789246 16:1676071-1676093 TGCACACAGCTCAGTGCTGTTGG - Exonic
1134765926 16:16757951-16757973 TCCAAACAGGCCAGTGCCATCGG - Intergenic
1134980122 16:18601263-18601285 TCCAAACAGGCCAGTGCCATCGG + Intergenic
1135120391 16:19761350-19761372 TCCAGATAGGTCCATCCTATGGG - Intronic
1135789574 16:25381276-25381298 TTCACACAGGTAAGTCCCTTAGG - Intergenic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138277074 16:55742919-55742941 ACCACAGAGGTGAGTCCTAGAGG + Intergenic
1138535574 16:57658534-57658556 CACACACAGGACAGTCATATAGG - Intronic
1144511614 17:15881921-15881943 TCCACACAGGCCAGGATTATGGG - Intergenic
1145699919 17:26821422-26821444 TCCATTCAAGTCAGTACTATTGG - Intergenic
1156167375 18:34438722-34438744 TCCACACAGATGATCCCTATTGG - Intergenic
1161687091 19:5708209-5708231 TCCACACAGGCCACTCCTTGGGG + Intronic
1165068061 19:33240501-33240523 TGCACACAGGTGAGTGCTGTGGG + Intergenic
1165074752 19:33274693-33274715 TCCACACAGTGCAGTGCTCTAGG + Intergenic
1166380155 19:42351424-42351446 TCCTCACAGGTCAGTCGCCTGGG - Exonic
925923537 2:8654244-8654266 TCCACACTCCTCAGTCCTTTGGG + Intergenic
930770165 2:55122609-55122631 CACACATGGGTCAGTCCTATGGG + Intergenic
932304478 2:70692130-70692152 TCTACTCAGGTCAGTCCTGTTGG - Intronic
932410677 2:71545575-71545597 ACCTCACAGGTCAGTACTCTTGG + Intronic
933738376 2:85513528-85513550 TCTACACAGGTCAGTCTCCTGGG - Intergenic
934770428 2:96904241-96904263 TCCATACAGCTCAGTCCTACGGG + Intronic
947773498 2:232689482-232689504 GTCACATAGGTCAGCCCTATTGG + Intergenic
947901748 2:233727137-233727159 ACCACACAGGTCAGTCTTTCAGG + Intronic
1168821254 20:775101-775123 TCCACCAAGGTCAGCCCCATGGG - Intergenic
1170211366 20:13849008-13849030 CTCTCACAGGTCATTCCTATAGG + Intergenic
1174743299 20:53037814-53037836 TGCACACAGGCAAGTCCTGTTGG - Intronic
1180076483 21:45465908-45465930 TCCAGACAGGCCAGTCCTCGAGG - Intronic
1183167233 22:36156830-36156852 GCCACCCAGGTCAGTCATAGGGG - Intronic
1185249425 22:49792293-49792315 TCCTCACAGCTCAGTCCTCAGGG + Intronic
951330586 3:21363779-21363801 TCTACACTGGAGAGTCCTATTGG - Intergenic
972107230 4:35504313-35504335 TACACATAGCTCAGGCCTATAGG - Intergenic
972416316 4:38844026-38844048 TCCACTCATGTCAGTACCATTGG - Intronic
974977291 4:68906559-68906581 TCCACACATGTCATTCCCGTTGG + Intergenic
976612029 4:87040272-87040294 TCCACACAGGCCTGTCCTTGAGG - Intronic
976701104 4:87969478-87969500 GCCAAACAGGTCAGGCATATAGG - Intergenic
977679794 4:99785982-99786004 TCCACACACCTCATTCCTCTTGG - Intergenic
985682164 5:1261765-1261787 CCCACACAAGTCAGACCCATAGG - Intronic
986851392 5:11817523-11817545 TCCCCACAGGTCAGGCCAACGGG + Intronic
989287316 5:39716706-39716728 TCCACTCAGTTCTGTGCTATGGG - Intergenic
995004195 5:107171201-107171223 ACCACAAATGTCAGTTCTATTGG + Intergenic
1003242219 6:4354481-4354503 TCCACACAGGTCCCTCCTGCAGG - Intergenic
1020071436 7:5229553-5229575 TCCACACAGGGCAGCCCTGCGGG - Intronic
1024691779 7:51810411-51810433 TCCACATTGGTCATTCCCATGGG + Intergenic
1026624150 7:71977558-71977580 GCCACACAGGTCTGTCTCATGGG + Intronic
1028422396 7:90648454-90648476 TCCACACAGGTCAGTCCTATTGG + Intronic
1028682116 7:93547613-93547635 TCCACACAGGTCAACCATGTGGG + Intronic
1038010195 8:23469470-23469492 TACACACAGGTCACTCCCAGGGG - Intergenic
1038061534 8:23919253-23919275 CACACACACATCAGTCCTATAGG - Intergenic
1039313588 8:36346898-36346920 TCCAGATGGGTCATTCCTATTGG - Intergenic
1044706882 8:95017467-95017489 TCCATACAGGTCAGCCCTCCAGG + Intronic
1045403841 8:101845465-101845487 TCCACACAAGCCATCCCTATTGG + Intronic
1047696306 8:127406667-127406689 TCCATACAGGTCAGTCTCCTGGG + Intergenic
1047773494 8:128049580-128049602 TCCACACAGGTCAGCCTTCTGGG - Intergenic
1048570323 8:135648618-135648640 TCCACACAGGTCAGGATAATTGG - Intronic
1048887621 8:138921032-138921054 CTCACACAGGTCCGGCCTATCGG + Intergenic
1049299128 8:141860586-141860608 TCCACAGAGGTCAGACCCCTGGG - Intergenic
1051857841 9:21589585-21589607 TCCACAGAGGTCAGTCTTCTGGG + Intergenic
1058888628 9:109342344-109342366 TCCACACAGGTGTGTCCTCGTGG - Intergenic
1060732720 9:126048424-126048446 TCCACCCGGGTCTGTCCTACTGG - Intergenic
1061722904 9:132564368-132564390 TCCTCACAAGTCAGACCTTTTGG - Intronic
1186366584 X:8901159-8901181 TCCAAACAGCTCTGTCCTTTCGG + Intergenic
1186439941 X:9577192-9577214 TGTTCACAGGGCAGTCCTATTGG - Intronic
1192315973 X:70052142-70052164 TCCAGCCAGGTGTGTCCTATGGG + Intergenic
1198756521 X:139987958-139987980 TCCACTCAGGTCAGTAATACTGG + Intergenic