ID: 1028423345

View in Genome Browser
Species Human (GRCh38)
Location 7:90658326-90658348
Sequence TAAGTGTGCAACCTAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028423345_1028423348 10 Left 1028423345 7:90658326-90658348 CCCTCTTCTAGGTTGCACACTTA 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG No data
1028423345_1028423347 3 Left 1028423345 7:90658326-90658348 CCCTCTTCTAGGTTGCACACTTA 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1028423347 7:90658352-90658374 AGTCTTACTGTATACTCAGATGG No data
1028423345_1028423349 11 Left 1028423345 7:90658326-90658348 CCCTCTTCTAGGTTGCACACTTA 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1028423349 7:90658360-90658382 TGTATACTCAGATGGTAGAAGGG 0: 1
1: 0
2: 16
3: 263
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028423345 Original CRISPR TAAGTGTGCAACCTAGAAGA GGG (reversed) Intronic
902341684 1:15787460-15787482 TCAGTGTGCAAGCTTGAAAAGGG - Intergenic
905190102 1:36227078-36227100 TAAGTGCACAAACTGGAAGATGG + Intronic
905798466 1:40828773-40828795 TAAGTCTGAAAGCTAAAAGAAGG - Intronic
908592603 1:65650268-65650290 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
908900545 1:68951415-68951437 ATAGTCTGCAACCTAGAAAATGG + Intergenic
909118290 1:71567905-71567927 GAAGTTAGCAACCTGGAAGAGGG + Intronic
910040956 1:82851244-82851266 GCAGTCTGCAACCTAGAAGTGGG - Intergenic
911924502 1:103811716-103811738 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
914446787 1:147757449-147757471 TAGGTGTACACCCTAGCAGAAGG + Exonic
916453969 1:164951406-164951428 AAAGTCAACAACCTAGAAGAAGG - Intergenic
917435358 1:175015750-175015772 TAAGTGTGCTAACAAGTAGATGG + Intronic
918802590 1:188990834-188990856 TAAGTGTGACACCTTGAAGCAGG - Intergenic
919230920 1:194773156-194773178 GCAGTCTGCAACCTGGAAGAAGG + Intergenic
921033049 1:211350817-211350839 TAAGTCTGCAGCCCGGAAGAGGG - Intronic
921941309 1:220842822-220842844 TAAGTGTGCAAGCAAGAAAATGG - Intergenic
923192737 1:231635576-231635598 TAAGTGTACTACATAGATGAGGG - Intronic
923785416 1:237063170-237063192 GCAGTCTGCAACCCAGAAGAGGG + Intronic
923991186 1:239438754-239438776 TAAGTGTGCATCTAAAAAGAAGG + Intronic
1063658417 10:8014691-8014713 CAAGTGTGCGAACAAGAAGAAGG + Exonic
1063851520 10:10197923-10197945 CCAGTCTGCAACCTGGAAGAGGG - Intergenic
1065073038 10:22047837-22047859 TAAGTCTGAAATCTACAAGATGG + Intergenic
1065451886 10:25867993-25868015 AAAGAGTTCAACCTAGAATAAGG - Intergenic
1066338942 10:34510209-34510231 CAGGTGGGCTACCTAGAAGAGGG - Intronic
1067123661 10:43496750-43496772 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
1067784563 10:49235587-49235609 TAATTGTGCAATCAAGATGATGG + Intergenic
1068706881 10:60086795-60086817 TCACTGTGGAACCAAGAAGACGG - Exonic
1070073607 10:73113740-73113762 TAATTATGCAACCAAGAAGTAGG + Intronic
1071056754 10:81520326-81520348 CAAGTTTGCAACCTGGAAGAAGG + Intergenic
1072615262 10:97045041-97045063 GAAGTCTGCAACCCAGAAGAGGG + Intronic
1074499248 10:114007979-114008001 CAGCAGTGCAACCTAGAAGAGGG - Intergenic
1076190143 10:128477164-128477186 TCAGAGTGCCACCAAGAAGAGGG + Intergenic
1079392197 11:20032282-20032304 TAACTGAGCCACCCAGAAGAGGG - Intronic
1079588208 11:22151299-22151321 GCAGTCTGCAACCTGGAAGATGG - Intergenic
1080032252 11:27674128-27674150 TGACTGTGCATCCCAGAAGAAGG - Exonic
1080660981 11:34295759-34295781 GCAGTCTGCAACCCAGAAGAGGG - Intronic
1081732263 11:45379916-45379938 TAACTGTTCCACCTGGAAGAGGG + Intergenic
1083340944 11:61958027-61958049 TAAGTGTGCAAGTCAGAACAAGG + Intronic
1084717938 11:70885359-70885381 GAAGAGTTCAACCCAGAAGACGG + Intronic
1084921043 11:72469826-72469848 CAGGTGTGAAACGTAGAAGATGG + Intergenic
1087187606 11:95217811-95217833 CAAATGTGCAACCTAGATAATGG + Intronic
1089231938 11:116985212-116985234 AAAGAGTCAAACCTAGAAGAGGG + Intronic
1090097518 11:123757493-123757515 TAAGTGTGGAGCATAGAAGAAGG - Intergenic
1090437982 11:126702758-126702780 TAAATGTGCACCCTAGGAGGTGG + Intronic
1091765207 12:3115602-3115624 TAAGTTTAGAACCCAGAAGAGGG - Intronic
1096018477 12:48300868-48300890 GCAGTTTGCAACCTGGAAGAGGG + Intergenic
1103348741 12:120268169-120268191 ACAGTCTGCAACCCAGAAGAGGG - Intergenic
1103707116 12:122881880-122881902 TAATTGTCGAACCTAGGAGACGG - Intronic
1103779976 12:123391980-123392002 TAAGTTTGCCACCTGAAAGAAGG + Intronic
1104299097 12:127547844-127547866 GAGGTGTGCTACCGAGAAGAGGG - Intergenic
1108429467 13:50339786-50339808 TGAGTTGGCAACCTGGAAGAGGG + Intronic
1110300822 13:73924642-73924664 TAAGTGTTCAACTGAGAGGAAGG + Intronic
1110549203 13:76792840-76792862 TAAGTTTGCATCCTGGAAGCCGG - Intergenic
1110715546 13:78699445-78699467 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
1111173926 13:84567280-84567302 CCAGTCTGCAACCTAGAAGAGGG - Intergenic
1111767774 13:92555873-92555895 TTAGAGTGCAGCCAAGAAGAAGG + Intronic
1112763597 13:102717917-102717939 ACAGTTTGCAACCCAGAAGAGGG + Intergenic
1112815155 13:103264263-103264285 GCAGTCTGCAACTTAGAAGAGGG - Intergenic
1115965673 14:38884813-38884835 GCAGTCTGCAACCTGGAAGAGGG + Intergenic
1116434963 14:44886720-44886742 TCAGTCTGCACCCTGGAAGAGGG - Intergenic
1116506428 14:45687925-45687947 TAAATGCGCAACCTACAAAATGG + Intergenic
1118077264 14:62313405-62313427 TGAGTCTGTAACCTAGAACAGGG + Intergenic
1118296748 14:64577105-64577127 GCAGTCTGCAACCTAGAAGAGGG - Intronic
1119953423 14:78769731-78769753 CAAGTGTGTAATCTAGAAAAGGG + Intronic
1120353709 14:83400388-83400410 TAACTGTGCCACTTACAAGAAGG - Intergenic
1126347331 15:47709791-47709813 TAAATGTGCAGCCTAGAGAAGGG - Intronic
1127864598 15:63022069-63022091 GTAGTCTGCAACCTGGAAGAGGG + Intergenic
1132182921 15:99774542-99774564 TTAGAGTGCAGCCAAGAAGAAGG - Intergenic
1132422780 15:101687888-101687910 GCAGTCTGCAACCTGGAAGAGGG + Intronic
1134213588 16:12298380-12298402 AAAGTATGAAACCTTGAAGAAGG - Intronic
1137742161 16:50789382-50789404 TAAGTGTGTAGGCTAGAAAAAGG - Intronic
1138041420 16:53673791-53673813 GAAGTGTGGAGCCTAGAAAAAGG - Intronic
1140917401 16:79506577-79506599 GAAGTGTAGAACCAAGAAGAGGG + Intergenic
1143699856 17:8650351-8650373 CCAGTCTGCAACCTGGAAGAGGG - Intergenic
1144401560 17:14908133-14908155 AAAATGTGTAACCTAGAAAATGG - Intergenic
1146150545 17:30465689-30465711 CATGTGTGCAACATAGAAAAAGG - Exonic
1148879292 17:50713410-50713432 GCAGTCTGCAACCCAGAAGAGGG - Intergenic
1148953512 17:51335113-51335135 GCAGTCTGCAACCCAGAAGAGGG - Intergenic
1153722173 18:7916530-7916552 GAAGTCTGCAACCCAGAAGAGGG - Intronic
1155719752 18:28996323-28996345 TAAGTGGGCAACTAAGCAGACGG + Intergenic
1156015850 18:32546606-32546628 TTGGTGTGCAACAGAGAAGAGGG - Intergenic
1156128900 18:33943847-33943869 TATGTGGGCTACATAGAAGATGG - Intronic
1156556125 18:38070123-38070145 GTAGTCTGCAACCTGGAAGAGGG - Intergenic
1157187899 18:45556078-45556100 GCAGTCTGCAACCCAGAAGAGGG - Intronic
1157463179 18:47920131-47920153 GCAGTCTGCAACCCAGAAGAGGG - Intronic
1157777907 18:50410845-50410867 TAATTGTTCAACCTAGCTGAAGG + Intergenic
1158939840 18:62397328-62397350 CCAGTCTGCAACCCAGAAGAGGG - Intergenic
1160313096 18:77816056-77816078 GCAGTTTGCAACCTTGAAGAGGG - Intergenic
1164434948 19:28221040-28221062 TAGGCCTGCTACCTAGAAGAGGG + Intergenic
1165137715 19:33680495-33680517 TCAGTGAGGAACCTTGAAGAGGG - Intronic
1165723209 19:38094146-38094168 TAAGTATGCAAAGTAGAAAAAGG + Intronic
1166332023 19:42083934-42083956 TGACTGTGCCACCTTGAAGATGG + Intergenic
928630320 2:33184972-33184994 TAAGTGTCAAGCCTAGATGAGGG + Intronic
929797856 2:45073766-45073788 GCAGTCTGCAACCTGGAAGAAGG + Intergenic
930426664 2:51221728-51221750 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
930576646 2:53158921-53158943 GCAGTCTGCAACCCAGAAGAGGG + Intergenic
932538785 2:72628691-72628713 GTAGTCTGCAACCCAGAAGAGGG + Intronic
932949008 2:76270958-76270980 GCAGTTTGTAACCTAGAAGAGGG - Intergenic
933993593 2:87651243-87651265 AAAGTCTTCAACCTGGAAGAGGG + Intergenic
934154952 2:89189756-89189778 TAAGTGTGGACCCAAGAAAAAGG + Intergenic
934212362 2:89992968-89992990 TAAGTGTGGACCCAAGAAAAAGG - Intergenic
935176541 2:100654069-100654091 TCAGTCTGCAACCCAGAAGAGGG - Intergenic
936300270 2:111299640-111299662 AAAGTCTTCAACCTGGAAGAGGG - Intergenic
937845238 2:126572463-126572485 GAAGTGTGCAACTAAGAAGTGGG - Intergenic
938396911 2:130957796-130957818 GTAGTCTGCAACCTGGAAGAGGG + Intronic
942718248 2:178919112-178919134 GCAGTCTGCAACCCAGAAGAGGG + Intronic
942752774 2:179306711-179306733 GTAGTCTGCAACCTGGAAGAGGG + Intergenic
943123840 2:183771987-183772009 TCAGTCTACAACCTAGGAGAGGG - Intergenic
943148612 2:184079692-184079714 GAAGTCTGCAAGCTAGAGGAGGG - Intergenic
943756814 2:191565621-191565643 TCGGTGTAGAACCTAGAAGAAGG - Intergenic
945968786 2:216216488-216216510 CAAGTCTGCAACCTAAAAGTGGG + Intergenic
947129815 2:226909709-226909731 GCAGTCTGCAACCTGGAAGAGGG + Intronic
947647583 2:231755107-231755129 GTAGTCTGCAACCTGGAAGAAGG + Intronic
1170592459 20:17781273-17781295 TCAGTGTGCAACCTGGGAGAGGG + Intergenic
1174456172 20:50650115-50650137 ATAGTCTGCAACCTGGAAGAGGG - Intronic
1174490190 20:50887441-50887463 AAAGTGTCCAACCAAGAGGAGGG - Intergenic
1174686969 20:52465430-52465452 GTAGTCTGCAACCTGGAAGAGGG - Intergenic
1175329933 20:58156495-58156517 AAAGTGGGCAGGCTAGAAGAAGG + Intronic
1175851190 20:62094064-62094086 GAAGGGTGCAAGCTGGAAGAGGG + Intergenic
1178047195 21:28709016-28709038 ACAGTCTGCAACCTGGAAGAAGG - Intergenic
1178482056 21:32988022-32988044 TAAGTCTGCAACTCGGAAGAGGG - Intergenic
1178508204 21:33180297-33180319 CAAGTGTACAACTCAGAAGAGGG + Intergenic
1184688080 22:46105327-46105349 GCAGTGTGCCTCCTAGAAGAAGG + Intronic
950469971 3:13178533-13178555 GAAGGGTGCAACCCAGAAGAGGG - Intergenic
953552737 3:43917005-43917027 GCAGTCTGCAACCCAGAAGAAGG + Intergenic
956763202 3:72461738-72461760 AAAGAGAGCAGCCTAGAAGAGGG + Intergenic
957318027 3:78593099-78593121 GCAGTCTGCAACCCAGAAGAGGG - Intergenic
959169564 3:102828714-102828736 ATAGTCTGCAACCTGGAAGAGGG + Intergenic
963892383 3:150650244-150650266 GGAGTCTGCAACCCAGAAGAAGG + Intergenic
965369673 3:167845712-167845734 GAAGTCTGCAACCTGGAAGAGGG + Intergenic
965664783 3:171081640-171081662 TAAAAATGCAACCTAAAAGAGGG - Intronic
968723615 4:2227193-2227215 TATGTGGGCAACCTACAATATGG - Intronic
970651811 4:18187080-18187102 GAAGTGGGCTATCTAGAAGAGGG + Intergenic
971526803 4:27630128-27630150 TAAGTCTTAAACCTAGAAGTCGG - Intergenic
971957229 4:33436808-33436830 TAACTGTGCAACCTTGGATAAGG - Intergenic
972187621 4:36550838-36550860 TCAGTCTGCAGCCTAGAATACGG - Intergenic
972451641 4:39206152-39206174 GAAGTCTGAAACCTAGAAGTAGG + Intronic
972977730 4:44658302-44658324 GCAGTCTGCAACCTGGAAGAGGG + Intronic
973316109 4:48762078-48762100 AAAGTCTGCAACCTGGAGGAGGG + Intronic
973539597 4:51922915-51922937 GCAGTCTGCAACCTGGAAGAGGG + Intergenic
973824368 4:54690409-54690431 TAAGTGCTGAACCTAGAAAATGG - Intronic
973850611 4:54957993-54958015 GTAGTCTGCAACCTGGAAGAGGG - Intergenic
975929214 4:79498083-79498105 GTAGTCTGCAACCTGGAAGAGGG - Intergenic
977472731 4:97461521-97461543 GCAGTCTGCAACCCAGAAGAGGG + Intronic
978822785 4:112985020-112985042 TAATTGTAAAACCTAGATGACGG - Intronic
979524820 4:121705799-121705821 TGAGTGTCCATCCTAGAAGTCGG + Intergenic
981536344 4:145803956-145803978 TGCTTGTGCAACCCAGAAGAGGG + Intronic
981538443 4:145824366-145824388 TCAGTGTCCAACCTAGAAAATGG + Intronic
983852211 4:172594994-172595016 GTAGTCTGCAACCTGGAAGAGGG - Intronic
985088686 4:186341954-186341976 GCAGTCTGCAACCCAGAAGAGGG - Intergenic
985962522 5:3313361-3313383 TAAGTGTGCAAGCAAGCACAGGG - Intergenic
986360784 5:6975935-6975957 TAAGTCTGAAACCTAGACTAAGG - Intergenic
987657616 5:20826774-20826796 GCAGTCTGCAACCTGGAAGAGGG - Intergenic
987915666 5:24209883-24209905 TAAGTGTGCTAACCAGGAGAGGG - Intergenic
987917631 5:24235962-24235984 TCAGTCTGCAACCTAGAAGAAGG - Intergenic
988765923 5:34377180-34377202 GCAGTCTGCAACCTGGAAGAGGG + Intergenic
989782815 5:45289865-45289887 GCAGTATGTAACCTAGAAGAGGG - Intronic
990512251 5:56499408-56499430 TAATTCTTCAACCTAGAAGGGGG + Intergenic
990902903 5:60772404-60772426 GCAGTCTGCAACCTGGAAGAGGG + Intronic
992279031 5:75154334-75154356 TAACTCTGCCACCTAGAAAAAGG + Exonic
993044475 5:82852044-82852066 TAATTGTGCAACGAAGAACAAGG + Intergenic
993769235 5:91904218-91904240 TCAGTTTGCAACCTGGAAGAGGG + Intergenic
995004814 5:107179482-107179504 GCAGTCTGCAACCTGGAAGAGGG + Intergenic
995309240 5:110692366-110692388 AAAGTGAGCAACGCAGAAGATGG + Intronic
995712554 5:115049997-115050019 TTGGTCTACAACCTAGAAGAAGG - Intergenic
995835444 5:116395810-116395832 ACAGAGTGCAACCTAGAAGGAGG - Intronic
997107841 5:131041573-131041595 TCAGTCTGCAACCCAGAAGAGGG + Intergenic
1001360701 5:171083362-171083384 GTAGTCTGCAACCCAGAAGAGGG + Intronic
1003288430 6:4756064-4756086 TAAGTGTGTGAACTAGAGGAAGG - Intronic
1003903163 6:10674090-10674112 GCAGTGTGCAACCCAGAAGAGGG - Intronic
1004231320 6:13836156-13836178 TGAGTGTGAAACCTACTAGACGG + Intergenic
1005566957 6:27105880-27105902 GAAGCCTGCAACCTGGAAGAGGG + Intergenic
1005596522 6:27383559-27383581 GCAGTCTGCAACCCAGAAGAGGG - Intronic
1005660220 6:27990721-27990743 GAAGTTTGCAACTCAGAAGAGGG - Intergenic
1006167854 6:32075802-32075824 TTAGTGAGCAAACTAGAAGGTGG + Intronic
1006764352 6:36491598-36491620 TAAGTGTGGAACTAATAAGAAGG + Intergenic
1006784795 6:36659078-36659100 CAAGACTGCAACCCAGAAGAGGG + Intergenic
1009924188 6:70099846-70099868 TCAGTGTGCATGCTGGAAGAGGG - Intronic
1010105727 6:72164876-72164898 TAAGTGTGAAACCTCAATGATGG - Intronic
1011213048 6:84974812-84974834 TCAGTATGCAACTCAGAAGAGGG - Intergenic
1011602755 6:89075207-89075229 GCAGTCTGCAACCCAGAAGAGGG - Intergenic
1014467812 6:121778230-121778252 TATGTGAGCACCCTACAAGATGG - Intergenic
1016544681 6:145207784-145207806 CAAGAGTGAAAGCTAGAAGAAGG - Intergenic
1016801847 6:148176849-148176871 GAAGTCTGCAACCCAGGAGAGGG + Intergenic
1021526593 7:21595162-21595184 GCAGTCTGCAACCTAGAAGAGGG - Intronic
1021800758 7:24304309-24304331 TAAGTGTTCAACCTCTTAGATGG - Intergenic
1022680884 7:32544816-32544838 TAAGTGTCCAACATCTAAGAAGG - Intronic
1023402566 7:39801058-39801080 TCAGTGTGCAAGCTTGCAGAGGG - Intergenic
1024204404 7:47144301-47144323 AAAATGTGAAAACTAGAAGATGG + Intergenic
1024647053 7:51379605-51379627 TCAGTGTGCAAGCTTGCAGAGGG + Intergenic
1026509566 7:71016835-71016857 GAAGTCTGCAACCCAGAAGAGGG - Intergenic
1028423345 7:90658326-90658348 TAAGTGTGCAACCTAGAAGAGGG - Intronic
1029790806 7:102841118-102841140 TAGGTGTGTCACATAGAAGAGGG + Intronic
1030678676 7:112411012-112411034 TAACTGTGCGATCTAGAAGGTGG + Intergenic
1030822959 7:114117843-114117865 TCAGTCTGCAAACCAGAAGAGGG - Intronic
1031756786 7:125654277-125654299 TAAGGGTGAAACTTAGAATAGGG + Intergenic
1033872632 7:145774780-145774802 TCAGTTTGCATCCCAGAAGAGGG + Intergenic
1034780468 7:153875175-153875197 TAAGAGTGCAAGTCAGAAGATGG + Intergenic
1034862654 7:154612984-154613006 GAAGTTTGCAGCCTAGAAGGTGG - Intronic
1035001847 7:155619073-155619095 TTATTGTGCAACCCAGAAGATGG - Intronic
1038984421 8:32793081-32793103 ACAGTGTGCAACCCAGAAGAGGG - Intergenic
1040607608 8:48950013-48950035 TTAGTCTGAAAGCTAGAAGAAGG + Intergenic
1041173510 8:55169796-55169818 TAAGTGTACAACTTTGAATAAGG + Intronic
1041219620 8:55636002-55636024 GCAGTTTGCAACCTGGAAGAGGG + Intergenic
1041437649 8:57860253-57860275 TGAGTGTGGAAACTGGAAGAAGG + Intergenic
1041588038 8:59544692-59544714 GAAGTGAACAACTTAGAAGACGG + Intergenic
1043604162 8:81979197-81979219 TAATTGTGCAGAGTAGAAGAAGG + Intergenic
1044147253 8:88732421-88732443 TCAGTGTGCAATCTGGAAGGAGG + Intergenic
1044817112 8:96124599-96124621 GAACAGAGCAACCTAGAAGAGGG - Intergenic
1045847514 8:106656326-106656348 TCAGTTTGCAAACCAGAAGAAGG - Intronic
1048206544 8:132420080-132420102 TCAGTCTGCACCCCAGAAGAGGG - Intronic
1049160154 8:141092365-141092387 TAAGTGTGGAAGAAAGAAGATGG + Intergenic
1050050529 9:1596354-1596376 CCAGTCTGCAACCCAGAAGAGGG - Intergenic
1051053836 9:12959892-12959914 CAAGTGGGCAACCCAGCAGAAGG + Intergenic
1051207499 9:14703877-14703899 AAAAAGTGCAACTTAGAAGAAGG + Intergenic
1052143568 9:25020520-25020542 TAAATGGGCAACCTACAAAATGG - Intergenic
1052697131 9:31892062-31892084 TATGTGTGGAACCTTGAAAAGGG + Intergenic
1055117450 9:72621015-72621037 CAAGTGAGCCACTTAGAAGAAGG + Intronic
1056448859 9:86695285-86695307 ATTGTGTGCAACCTAAAAGAAGG - Intergenic
1059288711 9:113201633-113201655 ATAGTCTGCAACCCAGAAGAGGG + Intronic
1060056586 9:120419150-120419172 GCAGTCTGCAACCTGGAAGAAGG + Intronic
1060146011 9:121253029-121253051 GTAGTCTGCAACCCAGAAGAGGG - Intronic
1188105001 X:26138913-26138935 GAAGAGGGCACCCTAGAAGACGG - Exonic
1189216538 X:39330009-39330031 TCAGTGTGCAATGTAGAAGGTGG - Intergenic
1190148376 X:47919627-47919649 GCAGTTTGCAACCTTGAAGAGGG - Exonic
1190412592 X:50151646-50151668 CAAGTCTGTAACCTGGAAGAGGG + Intergenic
1194619531 X:96152513-96152535 TATGTTTGAAAGCTAGAAGAAGG + Intergenic
1195631346 X:107058826-107058848 GTAGTCTGCAACCTGGAAGAGGG - Intergenic
1197506740 X:127314679-127314701 TCAGTCTGTAACCCAGAAGAAGG + Intergenic
1198506906 X:137310000-137310022 TAGCTGTGCAACCTCGAACAAGG + Intergenic
1200120130 X:153786261-153786283 TAGGAGTGCAGCCTAGAGGATGG + Exonic