ID: 1028423346

View in Genome Browser
Species Human (GRCh38)
Location 7:90658327-90658349
Sequence ATAAGTGTGCAACCTAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028423346_1028423349 10 Left 1028423346 7:90658327-90658349 CCTCTTCTAGGTTGCACACTTAT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1028423349 7:90658360-90658382 TGTATACTCAGATGGTAGAAGGG 0: 1
1: 0
2: 16
3: 263
4: 1271
1028423346_1028423348 9 Left 1028423346 7:90658327-90658349 CCTCTTCTAGGTTGCACACTTAT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG No data
1028423346_1028423347 2 Left 1028423346 7:90658327-90658349 CCTCTTCTAGGTTGCACACTTAT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1028423347 7:90658352-90658374 AGTCTTACTGTATACTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028423346 Original CRISPR ATAAGTGTGCAACCTAGAAG AGG (reversed) Intronic
903523735 1:23976150-23976172 AGAAATGTGCAAACTAGAATGGG - Intronic
906722108 1:48015770-48015792 ATATGAGTGCAACCTGGCAGGGG + Intergenic
909118289 1:71567904-71567926 AGAAGTTAGCAACCTGGAAGAGG + Intronic
909427233 1:75539898-75539920 ATAAATGAGCAACATAGAAAAGG + Intronic
909534393 1:76719648-76719670 TTAACTGTACACCCTAGAAGGGG - Intergenic
910040957 1:82851245-82851267 AGCAGTCTGCAACCTAGAAGTGG - Intergenic
910497209 1:87843914-87843936 ATAAGTGTGAAATCATGAAGAGG + Intergenic
918174815 1:182034063-182034085 AGCAGTCTGCAACCTGGAAGAGG + Intergenic
920163937 1:204021821-204021843 AAAAGTGTGCAACTAAGAAAGGG - Intergenic
921625721 1:217375704-217375726 ATAAGTGTCTAACCTCCAAGGGG - Intergenic
923192738 1:231635577-231635599 ATAAGTGTACTACATAGATGAGG - Intronic
1063495212 10:6501425-6501447 AGAGGTGTGCAACCAAGAAAGGG + Intronic
1072412416 10:95215825-95215847 GGTAGTCTGCAACCTAGAAGAGG - Intronic
1072615261 10:97045040-97045062 AGAAGTCTGCAACCCAGAAGAGG + Intronic
1073651107 10:105359242-105359264 GTAAGTGTCCAGGCTAGAAGTGG - Intergenic
1077543473 11:3158609-3158631 ACCAGTGTGCAGCCCAGAAGAGG - Intronic
1078175608 11:8967480-8967502 GTAAGTGTGCAAGTCAGAAGGGG + Intergenic
1079416563 11:20243349-20243371 TTAACTGAGCAACTTAGAAGAGG + Intergenic
1080067961 11:28042052-28042074 ATGAGTGTCCAAACTAGAAAGGG - Intronic
1081404058 11:42675929-42675951 ATAACTGTGCTACCTACAACAGG + Intergenic
1089487724 11:118860047-118860069 ATGTGTGTGAAACCTATAAGAGG - Intergenic
1090744476 11:129695296-129695318 AGAAGTGGGCAACCTGGAATTGG + Intergenic
1091765208 12:3115603-3115625 ATAAGTTTAGAACCCAGAAGAGG - Intronic
1092564422 12:9649368-9649390 ATAAGTGAGCAAGAGAGAAGTGG + Intergenic
1094062223 12:26326445-26326467 ATCAGCCTGCAACCCAGAAGAGG - Intergenic
1101824933 12:108212750-108212772 ATAATTGTGCCACACAGAAGGGG - Intronic
1103178959 12:118891036-118891058 GTAAGTCTGCAACCCAGAAAAGG - Intergenic
1103348742 12:120268170-120268192 AACAGTCTGCAACCCAGAAGAGG - Intergenic
1103642126 12:122359921-122359943 ATAAGTTTATTACCTAGAAGTGG - Intronic
1106352788 13:28949956-28949978 ATATGTATCCAACCCAGAAGGGG + Intronic
1107267764 13:38577719-38577741 GGAAGTCTGCAACCCAGAAGAGG - Intergenic
1111105072 13:83634672-83634694 ATAATTGTGCGACCTTGAAATGG + Intergenic
1111173928 13:84567281-84567303 ACCAGTCTGCAACCTAGAAGAGG - Intergenic
1112829907 13:103436736-103436758 TTAAGTGTGCATTCTAGAAGGGG - Intergenic
1113129709 13:107022680-107022702 ATAAGTTTGCAGTCTAGGAGAGG + Intergenic
1113384733 13:109838398-109838420 ATATGTGTGGAATTTAGAAGGGG + Intergenic
1116434964 14:44886721-44886743 ATCAGTCTGCACCCTGGAAGAGG - Intergenic
1118296749 14:64577106-64577128 GGCAGTCTGCAACCTAGAAGAGG - Intronic
1120108789 14:80528067-80528089 CTGAGTGTTCAAGCTAGAAGGGG + Intronic
1126430118 15:48574184-48574206 TTGAGTGTACAACCTAGATGGGG + Intronic
1127864597 15:63022068-63022090 AGTAGTCTGCAACCTGGAAGAGG + Intergenic
1128089384 15:64909076-64909098 AGAAGTGTGCAACCTAGGTTGGG + Intronic
1132422779 15:101687887-101687909 AGCAGTCTGCAACCTGGAAGAGG + Intronic
1137574708 16:49591323-49591345 ATAAGTGTGCAAAATAGTATAGG + Intronic
1143959313 17:10701682-10701704 ATAATTGTGGAAGCTAGAAATGG - Intronic
1145039819 17:19569388-19569410 CTAATTGTGCAAAGTAGAAGAGG + Intronic
1148953513 17:51335114-51335136 AGCAGTCTGCAACCCAGAAGAGG - Intergenic
1148977057 17:51538878-51538900 AGCCATGTGCAACCTAGAAGAGG - Intergenic
1149722724 17:58862582-58862604 ATAATTGTCCTACCTTGAAGGGG + Intronic
1150725458 17:67648017-67648039 ATAAGTTTGAAATCTAAAAGTGG + Intronic
1153418070 18:4872375-4872397 GGCAGTTTGCAACCTAGAAGAGG + Intergenic
1153722174 18:7916531-7916553 GGAAGTCTGCAACCCAGAAGAGG - Intronic
1156138869 18:34080347-34080369 AGCAGTGTGCAAAATAGAAGAGG - Intronic
1156556126 18:38070124-38070146 AGTAGTCTGCAACCTGGAAGAGG - Intergenic
1158053073 18:53247193-53247215 TTAAGAATGAAACCTAGAAGTGG + Intronic
1159103318 18:63978889-63978911 ATGATTATGCATCCTAGAAGAGG + Intronic
1160313097 18:77816057-77816079 AGCAGTTTGCAACCTTGAAGAGG - Intergenic
927228053 2:20789814-20789836 ACAGGTGTGCAACCTAGATCTGG - Intronic
930426665 2:51221729-51221751 AGCAGTCTGCAACCTGGAAGAGG - Intergenic
930576645 2:53158920-53158942 AGCAGTCTGCAACCCAGAAGAGG + Intergenic
935176542 2:100654070-100654092 GTCAGTCTGCAACCCAGAAGAGG - Intergenic
935607409 2:104984752-104984774 AGCAGTGTGGAACCCAGAAGTGG + Intergenic
936779868 2:116019245-116019267 AAAAGTGTGAAACGTAGATGTGG + Intergenic
937845239 2:126572464-126572486 AGAAGTGTGCAACTAAGAAGTGG - Intergenic
939350256 2:141027883-141027905 ATCAGTCTGCAACCTGGAAGAGG + Intronic
940658301 2:156515626-156515648 ATAATTTTGCAACCTATAACAGG - Intronic
942524994 2:176843557-176843579 AGCAGTCTGCAACCCAGAAGAGG - Intergenic
942699571 2:178689418-178689440 ATAAATGAGCAACATAGAAGTGG + Intronic
943148613 2:184079693-184079715 AGAAGTCTGCAAGCTAGAGGAGG - Intergenic
945968785 2:216216487-216216509 TCAAGTCTGCAACCTAAAAGTGG + Intergenic
947129814 2:226909708-226909730 AGCAGTCTGCAACCTGGAAGAGG + Intronic
947149749 2:227103330-227103352 ATAAGTGTGCTAATTAGAACAGG - Intronic
1170592458 20:17781272-17781294 TTCAGTGTGCAACCTGGGAGAGG + Intergenic
1170755073 20:19195705-19195727 AGCAATCTGCAACCTAGAAGAGG - Intergenic
1170880263 20:20290798-20290820 ACGAGTGTGCCACCTTGAAGTGG + Intronic
1171384785 20:24763015-24763037 AGAGGTGTGCAACCTGGCAGAGG + Intergenic
1173142869 20:40499543-40499565 ATAAGTATACATCCTTGAAGTGG - Intergenic
1174686970 20:52465431-52465453 AGTAGTCTGCAACCTGGAAGAGG - Intergenic
1175410634 20:58765644-58765666 ATGAGTCTGAAACCTGGAAGGGG - Intergenic
1175782002 20:61688832-61688854 AGGAGTGTGCAACCCAGCAGGGG + Intronic
1175851189 20:62094063-62094085 AGAAGGGTGCAAGCTGGAAGAGG + Intergenic
1177114115 21:17065002-17065024 AAAGGTCTGCAACCCAGAAGAGG - Intergenic
1177762187 21:25414640-25414662 GGAAGTCTGCAACCCAGAAGGGG - Intergenic
1178295745 21:31408868-31408890 ATAAATCGGAAACCTAGAAGTGG + Intronic
1178508203 21:33180296-33180318 ACAAGTGTACAACTCAGAAGAGG + Intergenic
1180356037 22:11840799-11840821 ATAAGTGGGTAACTTACAAGTGG - Intergenic
1180382219 22:12151527-12151549 ATAAGTGGGTAACTTACAAGTGG + Intergenic
1181410459 22:22714796-22714818 ATAAGTGTGAACCCAGGAAGAGG + Intergenic
1182084735 22:27553783-27553805 ATGACTCTGCCACCTAGAAGGGG - Intergenic
950469972 3:13178534-13178556 AGAAGGGTGCAACCCAGAAGAGG - Intergenic
953394444 3:42556217-42556239 CTAAGTCTGCAACCTGGAATGGG + Intronic
954845636 3:53553161-53553183 ATAAGTGTGTCAACTAGAATTGG - Intronic
955445095 3:59001420-59001442 ATAAGTGTGAAACTTAAGAGAGG - Intronic
956763201 3:72461737-72461759 AAAAGAGAGCAGCCTAGAAGAGG + Intergenic
957318028 3:78593100-78593122 AGCAGTCTGCAACCCAGAAGAGG - Intergenic
959169563 3:102828713-102828735 AATAGTCTGCAACCTGGAAGAGG + Intergenic
960393298 3:117105404-117105426 ATATGTGTGCATCCCAGTAGGGG - Intronic
965244626 3:166250611-166250633 ATAAGTGTGTAACCATGAAAGGG + Intergenic
965369672 3:167845711-167845733 GGAAGTCTGCAACCTGGAAGAGG + Intergenic
965733311 3:171795273-171795295 ATACATGTGCAATCCAGAAGTGG + Intronic
967367407 3:188702989-188703011 ATAAGTGAGCAACCTTGTAGAGG - Intronic
967401367 3:189066056-189066078 ATAAATTGGAAACCTAGAAGTGG + Intronic
972977729 4:44658301-44658323 AGCAGTCTGCAACCTGGAAGAGG + Intronic
973049073 4:45572452-45572474 AGCAGTCTGCAACCAAGAAGTGG - Intergenic
973539596 4:51922914-51922936 AGCAGTCTGCAACCTGGAAGAGG + Intergenic
974717906 4:65694327-65694349 ATGAGAGTGCAAACTATAAGGGG - Intergenic
975009166 4:69327468-69327490 ATAAGTCTGGAACTAAGAAGTGG - Intronic
975031847 4:69630369-69630391 ATAAGAGTGTAACCGGGAAGAGG - Intronic
975419199 4:74142455-74142477 AGAAGTCTGTAACCTAGAAGAGG + Intronic
977472730 4:97461520-97461542 AGCAGTCTGCAACCCAGAAGAGG + Intronic
981536343 4:145803955-145803977 ATGCTTGTGCAACCCAGAAGAGG + Intronic
984647033 4:182231406-182231428 ATAATTATGCATGCTAGAAGAGG - Intronic
985088687 4:186341955-186341977 AGCAGTCTGCAACCCAGAAGAGG - Intergenic
986221040 5:5768983-5769005 ATAAGTTTGCAACCTAAGAAGGG + Intergenic
987657617 5:20826775-20826797 AGCAGTCTGCAACCTGGAAGAGG - Intergenic
988738292 5:34044621-34044643 ATAAGTGTGGACTCTGGAAGCGG - Intronic
988765922 5:34377179-34377201 AGCAGTCTGCAACCTGGAAGAGG + Intergenic
990512250 5:56499407-56499429 TTAATTCTTCAACCTAGAAGGGG + Intergenic
993769234 5:91904217-91904239 TTCAGTTTGCAACCTGGAAGAGG + Intergenic
994187647 5:96833027-96833049 ATCAGTCTACAACCTGGAAGAGG + Intronic
995004813 5:107179481-107179503 AGCAGTCTGCAACCTGGAAGAGG + Intergenic
996039478 5:118794040-118794062 AGCAGTCTGCAACCTGGAAGAGG - Intergenic
996042446 5:118830983-118831005 ATCTGTATGAAACCTAGAAGTGG - Intergenic
997107840 5:131041572-131041594 ATCAGTCTGCAACCCAGAAGAGG + Intergenic
998064903 5:139150259-139150281 TTAAGTGTGGAACATACAAGAGG - Intronic
998664210 5:144277389-144277411 CTTAGTGTGCACCCTACAAGAGG - Intronic
999940196 5:156533963-156533985 AAAAGTCTTCAACCTAAAAGAGG - Intronic
1000670643 5:164058548-164058570 ATATTTATGCAACCTAGTAGGGG - Intergenic
1003903164 6:10674091-10674113 GGCAGTGTGCAACCCAGAAGAGG - Intronic
1005566956 6:27105879-27105901 AGAAGCCTGCAACCTGGAAGAGG + Intergenic
1005660221 6:27990722-27990744 AGAAGTTTGCAACTCAGAAGAGG - Intergenic
1006784794 6:36659077-36659099 ACAAGACTGCAACCCAGAAGAGG + Intergenic
1006805298 6:36784498-36784520 ATATGTGTGAACCCAAGAAGAGG + Intronic
1010033136 6:71289901-71289923 AGAAGTGTGCATCCTGGAGGTGG + Intronic
1010390546 6:75331995-75332017 AGAAGTCTGCAACCAGGAAGAGG + Intronic
1010735163 6:79435884-79435906 AGCTGTCTGCAACCTAGAAGAGG - Intergenic
1011213049 6:84974813-84974835 ATCAGTATGCAACTCAGAAGAGG - Intergenic
1011400006 6:86950481-86950503 ATACCTTTGCAGCCTAGAAGTGG - Intronic
1016801846 6:148176848-148176870 AGAAGTCTGCAACCCAGGAGAGG + Intergenic
1021526594 7:21595163-21595185 GGCAGTCTGCAACCTAGAAGAGG - Intronic
1022601785 7:31767782-31767804 AGCAGTCTGCAACCTGGAAGAGG - Intronic
1026509567 7:71016836-71016858 GGAAGTCTGCAACCCAGAAGAGG - Intergenic
1028423346 7:90658327-90658349 ATAAGTGTGCAACCTAGAAGAGG - Intronic
1031224685 7:119021120-119021142 AATAGTGTGCAATCCAGAAGTGG - Intergenic
1033872631 7:145774779-145774801 ATCAGTTTGCATCCCAGAAGAGG + Intergenic
1037610443 8:20471608-20471630 AGTAGTCTGCAACCCAGAAGAGG + Intergenic
1038984422 8:32793082-32793104 AACAGTGTGCAACCCAGAAGAGG - Intergenic
1041219619 8:55636001-55636023 AGCAGTTTGCAACCTGGAAGAGG + Intergenic
1043246967 8:78015727-78015749 ATAAGTGGGCAAGATAGAAATGG - Intergenic
1043341629 8:79246986-79247008 GTAATTGTGCATCATAGAAGAGG + Intergenic
1043778000 8:84294834-84294856 GTAGGTGGGCAACCTAGAATGGG + Intronic
1044537477 8:93374168-93374190 AACAGTCTGCAACCTGGAAGGGG - Intergenic
1044868927 8:96599317-96599339 ATGAGTCATCAACCTAGAAGTGG - Intronic
1045230340 8:100300000-100300022 ATAAGAGTGCAATCTGTAAGAGG + Intronic
1045998381 8:108390330-108390352 ATTAATGTGCATCCTAAAAGAGG + Intronic
1051699944 9:19811207-19811229 GACAGTCTGCAACCTAGAAGGGG + Intergenic
1051919007 9:22241844-22241866 ATAAGTGTGCAATGAAGATGAGG - Intergenic
1052697130 9:31892061-31892083 ATATGTGTGGAACCTTGAAAAGG + Intergenic
1052892730 9:33719313-33719335 AGAAGTGGGCAACCTGGAATTGG + Intergenic
1185977878 X:4741798-4741820 AATAGTGTGCAAAATAGAAGAGG + Intergenic
1188457751 X:30386627-30386649 ATAAGTATTCCACATAGAAGTGG - Intergenic
1189466981 X:41284907-41284929 ATGAGTGCACAACCAAGAAGCGG + Intergenic
1190148377 X:47919628-47919650 AGCAGTTTGCAACCTTGAAGAGG - Exonic
1190446684 X:50532697-50532719 ATAAATATTCAACCTAGCAGTGG - Intergenic
1193418540 X:81254783-81254805 CTGAGTGTGCAGCCTTGAAGAGG + Intronic
1195118289 X:101722348-101722370 GGAAGTCTGCAACCTAGAAGAGG + Intergenic
1195631347 X:107058827-107058849 AGTAGTCTGCAACCTGGAAGAGG - Intergenic
1198760008 X:140022439-140022461 ATGAGTGAGCAATCTTGAAGTGG - Intergenic
1201698073 Y:16849666-16849688 AGTAGTGTGCAAAATAGAAGAGG - Intergenic