ID: 1028423348

View in Genome Browser
Species Human (GRCh38)
Location 7:90658359-90658381
Sequence CTGTATACTCAGATGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028423345_1028423348 10 Left 1028423345 7:90658326-90658348 CCCTCTTCTAGGTTGCACACTTA 0: 1
1: 0
2: 1
3: 19
4: 209
Right 1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG No data
1028423346_1028423348 9 Left 1028423346 7:90658327-90658349 CCTCTTCTAGGTTGCACACTTAT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028423348 Original CRISPR CTGTATACTCAGATGGTAGA AGG Intronic
No off target data available for this crispr