ID: 1028428103

View in Genome Browser
Species Human (GRCh38)
Location 7:90713553-90713575
Sequence TTGTGGGGAGAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1568
Summary {0: 1, 1: 3, 2: 20, 3: 160, 4: 1384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028428103 Original CRISPR TTGTGGGGAGAGAGGGAAGA TGG Intronic
900080031 1:849722-849744 TTGTGGTGAGACAGTGAGGAAGG + Intergenic
900193167 1:1360013-1360035 CCATGGGGAGAGAGGGAACAGGG - Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
901380511 1:8870639-8870661 TTCTGGGGGGAAAGGGGAGAGGG - Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901801735 1:11712080-11712102 ATGTGGGGAGAGGGGGAGCATGG + Intronic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902392075 1:16112666-16112688 TTGGGGGGTCAGAGGGAAGGGGG + Intergenic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902490144 1:16775530-16775552 ATGTGGGGAGAAACGGGAGAAGG - Intronic
902533422 1:17105062-17105084 CTGTGGGGAGAGATGAGAGAGGG + Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902661345 1:17906140-17906162 TTTTGAGGAGAGAATGAAGAGGG - Intergenic
902664537 1:17928179-17928201 TTAGGAGGAGTGAGGGAAGAAGG + Intergenic
902800608 1:18827298-18827320 TGGGAGGGAGAGTGGGAAGAGGG - Intergenic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
902997843 1:20240913-20240935 TTGTTGGGATAGAGGCAACATGG + Intergenic
902998903 1:20250344-20250366 TTTTTGGGAGAAAGGGAAGAAGG + Intergenic
903398039 1:23017622-23017644 TTGTGGGGAGAAAGATGAGAAGG - Intergenic
903757543 1:25672988-25673010 ATGCGGGGAGAGAGGGCAGCTGG + Intronic
903808210 1:26020445-26020467 GTATGGGGATAGAGGGATGAAGG + Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903836123 1:26204236-26204258 TGTTGGCCAGAGAGGGAAGAAGG + Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903862063 1:26370583-26370605 TTGGGAGGAGTGAGGAAAGAGGG - Intronic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
904163644 1:28538750-28538772 GGGTGGGGAGAGAGGGTGGAGGG + Intronic
904279616 1:29409604-29409626 TTGTGGGGGGAGAATGATGAAGG + Intergenic
904301503 1:29557471-29557493 TGGGAGGGAGAGAGGGAAGAAGG + Intergenic
904383334 1:30125784-30125806 AGGTGGGGAGAGAGGGGAGGGGG + Intergenic
904594848 1:31637140-31637162 TTGTGGGGAGGGCAGGAAGCAGG + Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905209815 1:36366367-36366389 TTGTGGGGGAAGAGGGAGCAAGG + Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905427180 1:37895498-37895520 CTGTGGGGAGAGAGAGAGGGAGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905890981 1:41518266-41518288 TTGGAGGGAGAGAGGGGAGGAGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906532968 1:46533861-46533883 AAGTGAGGAGAGAGGGAGGATGG - Intergenic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
906931083 1:50170159-50170181 TTGTGGGGCATGAGAGAAGAAGG + Intronic
906997689 1:50815226-50815248 TAGAGGGGAGAGAGGGGAGGTGG - Intronic
907178318 1:52546512-52546534 TTGTCAGGGGTGAGGGAAGAAGG + Intronic
907294745 1:53443270-53443292 TTTGGGGGAGAGTGGGAAGGAGG + Intergenic
907335543 1:53697138-53697160 TTGTCTGGATAGTGGGAAGACGG + Intronic
907364466 1:53946828-53946850 TTGGGGAGAGAGCGGGAAGAAGG + Intronic
907915081 1:58861134-58861156 AGGGAGGGAGAGAGGGAAGAAGG + Intergenic
907954403 1:59214614-59214636 TTTGGGGGAGTCAGGGAAGAGGG - Intergenic
907975468 1:59427268-59427290 TTGTGGGGAGGGAGGCAGCAAGG - Intronic
908080128 1:60568309-60568331 GAGAGGGGAGAGAGGGAGGAGGG - Intergenic
908193606 1:61727711-61727733 TTTTGGAGGGAGAGGGAGGACGG - Intergenic
908370028 1:63472465-63472487 TGGAGAGGAGAGAGGGGAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908600193 1:65730597-65730619 TTGTGAAGAGAGAGGCAAGTGGG + Intergenic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
909388320 1:75086633-75086655 TTGTGGGAAGTGGAGGAAGAGGG + Intergenic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
910352082 1:86309343-86309365 TAGAAGGGAGAGAGGGTAGATGG - Intergenic
910479883 1:87646925-87646947 TTGTGGGGAAAGAGGAAAGGAGG + Intergenic
910884449 1:91950443-91950465 TTTTGGGGGGAGCGGGGAGACGG - Intronic
911001755 1:93173055-93173077 ACTTGGGGAGAGAGGGAATAGGG + Intronic
911276418 1:95864977-95864999 TTGTGGGGAGAGAGGAAGGGAGG - Intergenic
911330799 1:96523614-96523636 TTAAGAGGAGAGAGGGGAGAGGG - Intergenic
912449577 1:109760838-109760860 TGGTGGGGAGAGCAGGCAGAGGG - Intronic
912517853 1:110227165-110227187 GTTTGGGGACAGAGGGAAGTGGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913152432 1:116057907-116057929 TTGGGTGGGGAGAGGGGAGAAGG + Intronic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913385349 1:118252974-118252996 TTGAAGGGAAAGAGGGAGGAAGG - Intergenic
913963612 1:143357141-143357163 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914057972 1:144182730-144182752 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914121174 1:144783635-144783657 AAGAGAGGAGAGAGGGAAGAGGG + Intergenic
914357395 1:146898715-146898737 TCACGGGGAGAGAGGGAGGAAGG - Intergenic
914454878 1:147826642-147826664 TTGGGGGAAGCGTGGGAAGAGGG - Intergenic
914465206 1:147922176-147922198 TGGAGGGGAGTGAGGGAAGGGGG - Intergenic
914675283 1:149903472-149903494 ATGTGGGGAGTGAGGGACAAGGG + Exonic
914684677 1:149967859-149967881 TGGTGGGAGGAGAGGGAATAAGG + Intronic
914772170 1:150697358-150697380 TTGGTGGAAGAGAGGAAAGAGGG + Intergenic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915083692 1:153369790-153369812 TTGAGGGGAGAGCCTGAAGATGG - Intergenic
915107021 1:153541080-153541102 TTGTGGTGGGAGAGGAATGATGG - Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915334116 1:155130498-155130520 GAGAGGGGAGAGAGGGGAGAGGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915584416 1:156836500-156836522 GGGTAGGGAGAGAGGCAAGAAGG + Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915701338 1:157799637-157799659 TTGTGGGGTGCGGGGGAGGAGGG + Intronic
915736993 1:158091332-158091354 TGGTGGAGAGGGAAGGAAGAAGG - Intronic
915780028 1:158537812-158537834 GTGTAGGGAGAGAGGGCAGTGGG - Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
915885431 1:159716499-159716521 TGGGAGGGAGAGAGGGAGGAAGG + Intergenic
915969923 1:160347427-160347449 CTGTGGGGACAGACGAAAGAAGG - Intronic
916004624 1:160648119-160648141 TTGTGGGCATAGAGAGTAGAAGG - Intergenic
916666613 1:166973520-166973542 TTGCAGGGAGTGAGAGAAGAAGG - Intronic
916736725 1:167614151-167614173 AGGGCGGGAGAGAGGGAAGAAGG - Intergenic
916750515 1:167719501-167719523 TTGAGGGGAGTGAGGGAAAGAGG - Intergenic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917134964 1:171781036-171781058 CTTTGCGGAGAGAAGGAAGAGGG + Intergenic
917325075 1:173824088-173824110 TTGTGGAGCGAGAGGGAATTTGG - Intronic
917519999 1:175740519-175740541 TGGTGGGGAAAGATGGAAGGAGG - Intronic
917830578 1:178880377-178880399 TTATGGTGTGAGAGAGAAGATGG - Intronic
918029669 1:180793109-180793131 AAGGAGGGAGAGAGGGAAGAAGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918111694 1:181460311-181460333 TTCAGGGGAGAGATGGATGATGG + Intronic
918170175 1:181988870-181988892 TTGGGAGGAGAGAGGGAGAATGG - Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918407367 1:184224166-184224188 GGGTGGAGAGAGAGGGAAGGAGG - Intergenic
918477336 1:184939381-184939403 TTGTGGGGACAGTAGGAATAGGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918644368 1:186885931-186885953 TTGGGAAGAGAGAGGGAATAGGG + Intronic
918761875 1:188420629-188420651 AGGGAGGGAGAGAGGGAAGAAGG - Intergenic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919161366 1:193835055-193835077 TTATGGGGAGAGAGGTAGGGAGG + Intergenic
919260047 1:195180540-195180562 GAGTGGGGAGAGAAGAAAGAGGG - Intergenic
919276820 1:195428858-195428880 TTGTGGGGTTAGAAGCAAGATGG + Intergenic
919394314 1:197025128-197025150 GGGAGGGGAGAAAGGGAAGAGGG - Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
920050355 1:203161153-203161175 TTGAGGAGAGAAATGGAAGAGGG - Intronic
920081147 1:203373683-203373705 TGGGGAGGAGAAAGGGAAGAAGG + Intergenic
920558008 1:206918353-206918375 GTGAGGGGAGAGAGGGAGGGAGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921012983 1:211161394-211161416 TGGTGAGGAGAGACGGAAGTGGG + Intergenic
921095299 1:211882069-211882091 GAGTGGGGAGAGAGGGATGGGGG - Intergenic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
921331367 1:214041054-214041076 TTGTGGGGAGGGTGGGAAAGGGG + Exonic
921563405 1:216686203-216686225 TAGTGGGGAGACAGGGAGGAGGG + Intronic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
922489281 1:226002653-226002675 TTGTGCGCAGAGAGGAAAGGTGG + Intergenic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922997587 1:229977000-229977022 TGGTGGTGACAGAGGGAAGTAGG + Intergenic
923143750 1:231183605-231183627 TTGTTGGGAGGGAGGGATGGGGG - Intronic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923266550 1:232319841-232319863 ATGTGGGGAGAGAGGGGTCATGG + Intergenic
923273850 1:232380020-232380042 TTGCTGGGAGAGAGGGGAAAAGG - Intergenic
923339533 1:232995842-232995864 TTATAGGAAGAAAGGGAAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923455816 1:234164357-234164379 TTGAGGAGAGAGGGGAAAGAAGG - Intronic
923530294 1:234807000-234807022 ATGTGGGGAGAAACGGGAGAAGG + Intergenic
923948262 1:238916142-238916164 TTGTGGAGTGAGAGGGTTGAAGG - Intergenic
923991902 1:239447394-239447416 ATGTGGGGAGAGAGAGAGAATGG + Intronic
924592774 1:245419481-245419503 TTTGGGGGAGGGAGGCAAGAGGG - Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063169829 10:3498421-3498443 TCGTGGGGAAAGAAAGAAGAGGG + Intergenic
1063361055 10:5459217-5459239 TTGTGGGGCGTCAGGGTAGAGGG + Intergenic
1063431989 10:5999247-5999269 TTCTGGGTAGAGTGGGCAGACGG + Intergenic
1063979932 10:11444786-11444808 TTGTGGGGGGAGAGGGAGCGAGG - Intergenic
1064193675 10:13228512-13228534 AGGTGGGGTGAGAGGGTAGAAGG + Intronic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065078758 10:22107247-22107269 TGGTAGGGAGAGTGGGAGGATGG - Intergenic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065359926 10:24879920-24879942 CTGTGGGGTGAGTGGGGAGAAGG + Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065990072 10:31000454-31000476 TTGTGGGGGTAGAGAGAAAAAGG - Intronic
1066205795 10:33188168-33188190 TTGAGGGGACAGAGGCACGATGG - Intronic
1066347169 10:34599085-34599107 GTGTGGGGAGAGACGGGTGATGG - Intronic
1067061102 10:43078299-43078321 TTGTAAGGAGTGAGGGAGGATGG - Intronic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067701377 10:48575553-48575575 TGGTGGGGAGAAAGTCAAGATGG - Intronic
1068830716 10:61491573-61491595 GGAGGGGGAGAGAGGGAAGAGGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069919595 10:71808418-71808440 TGGGAGGGAGAGTGGGAAGATGG - Intronic
1070263030 10:74876205-74876227 GGGTGGGGAGTGGGGGAAGAAGG - Intronic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070600392 10:77862236-77862258 TTTTAGGGAGAGAGATAAGATGG - Intronic
1070735419 10:78860729-78860751 GGGTGGGGAGAATGGGAAGAAGG + Intergenic
1070771087 10:79082700-79082722 TTGTGTGGAGTGAAGGACGATGG + Intronic
1070916960 10:80161174-80161196 GTGAGGGCAGAGAGGGGAGAGGG - Intronic
1070977117 10:80614317-80614339 ATGTGGCGAGAGTGGGAGGAAGG + Intronic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071301796 10:84261589-84261611 TTGTGGGGTGAGTGGGAAGGAGG - Intergenic
1071374699 10:84990680-84990702 TTGAGGGGAGAGAAAGCAGAGGG + Intergenic
1071791975 10:88964569-88964591 TTCTTGGTAGAGAGGGAAGGAGG + Intronic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072984271 10:100126000-100126022 TTGTGGGCAGAGTGTGAAGGAGG + Intergenic
1073186156 10:101616164-101616186 TTTTGGAGAGAGAGAGAGGAGGG + Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1074351827 10:112745174-112745196 TTGTGGAGAGAGTAGGAAGAGGG + Intronic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1075153488 10:119955664-119955686 GTGTGGGGAGAGAGGACAGCAGG + Intergenic
1075216389 10:120539801-120539823 TTGGGAGGAGTGAGGGAGGAAGG + Intronic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075781524 10:125020491-125020513 TTGTGGAGACAGACAGAAGAGGG + Intronic
1076347758 10:129791759-129791781 TGGTGGGGAGTGGAGGAAGAGGG - Intergenic
1076686988 10:132202625-132202647 TTCTGGGGAGAGAGGCCCGAGGG - Exonic
1076830025 10:132989434-132989456 TTGTGGGGTGAGAGTGGTGAGGG - Intergenic
1076923864 10:133471511-133471533 TTGTGGGGAGACAGCCCAGAGGG - Intergenic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077223383 11:1427118-1427140 CTGTGGGGAGAGAGGGGATGGGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077359433 11:2134196-2134218 TGTGGGGGAGAGGGGGAAGACGG - Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077609328 11:3634831-3634853 TGGTGGGGAGAGAGGAAACGGGG + Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078013463 11:7592260-7592282 TTGTGGGCAGACAGGAGAGAAGG - Intronic
1078040378 11:7856110-7856132 TGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079103892 11:17558439-17558461 CTGTGGGGAGAGGGAGAGGAAGG - Intronic
1079241659 11:18726289-18726311 TTGTGGGGGGAGGGGGAGGGCGG + Intergenic
1079272592 11:19002778-19002800 GAGTGGGGAGAGTGGGAGGAGGG - Intergenic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1080547525 11:33335686-33335708 TGGTGGGGAGAGAGCTCAGAGGG + Intronic
1080737731 11:35033337-35033359 TTGAGGGCAGAAAGGAAAGAGGG - Intergenic
1080928248 11:36781116-36781138 TTGAAGGGAGAAAGGGTAGATGG - Intergenic
1081321835 11:41700790-41700812 TTGTGGGGATAGAAGCAATATGG + Intergenic
1081621268 11:44620271-44620293 TTGTAGGGGGAGAGGGGAGGGGG + Exonic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082747481 11:56980807-56980829 TAAAAGGGAGAGAGGGAAGAAGG + Intergenic
1082803268 11:57429898-57429920 TTATGGACAGAGTGGGAAGATGG + Intergenic
1083150442 11:60788711-60788733 TAGTGGGGTGAGTGGGCAGAGGG - Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083550951 11:63589922-63589944 GGGTGGGGAGAGAGGCAAGTTGG - Intronic
1083909564 11:65698176-65698198 TTGAGGGGAGTGAGGGAGGGTGG - Intergenic
1083996290 11:66274718-66274740 AAGAGGGGAGAGGGGGAAGAGGG - Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084628048 11:70324015-70324037 TGCTGGAGAGAGAGGAAAGATGG - Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084947975 11:72649138-72649160 TGGTGGGGAGAGTGGCCAGAAGG - Intronic
1085277165 11:75307606-75307628 TTCTGGGGAGAGGGAGCAGATGG - Intronic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086245125 11:84742549-84742571 TTGTGGGGACAGAGGTATGTAGG - Intronic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1086748334 11:90457719-90457741 GACTGGGGAGAGAGGGAAGTGGG + Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087772548 11:102226323-102226345 ATGAGGGGAGAGAGAGAACAAGG + Intronic
1087999838 11:104864510-104864532 TAGTGTGGAGAGTGGGAGGAGGG - Intergenic
1088327653 11:108617272-108617294 TTGTGGGGAGTGAGAGGATAAGG + Intergenic
1088363518 11:109016243-109016265 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363563 11:109016415-109016437 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088363599 11:109016547-109016569 TAGAGGGGAGAGATGGGAGATGG + Intergenic
1088447385 11:109946730-109946752 TTTTGGGGAGAGAGGGGAAGGGG - Intergenic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1089248278 11:117138079-117138101 TTGTCGGGGGAGGGGGCAGAGGG + Intergenic
1089258433 11:117206482-117206504 TTGTCGGGGGAGGGGGCAGAGGG - Intronic
1089592944 11:119556389-119556411 TTGGTGGCAGAGAGGGGAGAAGG + Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1089687616 11:120166751-120166773 TGGGGAGGAGAGAGGGAAGGAGG + Intronic
1089725479 11:120474659-120474681 TTTTGGGGAGAGTGGCAAAAGGG + Intronic
1090171963 11:124613192-124613214 TGGTGGGGATAGAGGCAAGAGGG - Intronic
1090229078 11:125088855-125088877 CTGTGGGGAGAGTAGAAAGAGGG + Exonic
1090280483 11:125451979-125452001 TTGCAGGGAGAGAGAGAACAGGG + Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090552906 11:127842316-127842338 GTTTAGGGAGAAAGGGAAGAAGG - Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091215591 11:133899494-133899516 TTGGGGAGGGAAAGGGAAGATGG - Intergenic
1091268362 11:134288258-134288280 TAATGAGGAGAGTGGGAAGAGGG + Intronic
1091300159 11:134502471-134502493 TGGGGGAGAGAGAGGGAAGGAGG - Intergenic
1091618237 12:2066304-2066326 TTGGGGAGAGAGAGAGCAGAGGG + Intronic
1091652163 12:2318735-2318757 ATGGAGGGAGAGAGGGAAGGAGG + Intronic
1091977962 12:4841757-4841779 TAGAGAGGAGAGAGGGAAGCAGG + Intronic
1092106510 12:5925406-5925428 TTGTGGGGAGAGGGAGAGAAGGG - Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1092629267 12:10361072-10361094 TTGTAGAGACAGAGGGAGGAGGG + Intergenic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1092975974 12:13745296-13745318 TGGTGGGAAGAGAGAGCAGATGG + Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094120495 12:26969057-26969079 TTTAGGGGAGAGAGTGAGGAGGG + Intergenic
1094166772 12:27451316-27451338 TTGTGGGGAGAGGGGGACCCTGG + Intergenic
1094467317 12:30767009-30767031 TTATGGGGAGAGCAGCAAGAAGG - Intergenic
1094701139 12:32871977-32871999 GAGTGGGGAGAGAGAGAAGGAGG - Intronic
1095199666 12:39368606-39368628 TTGGAGGGTGAAAGGGAAGATGG + Intronic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1095476018 12:42588670-42588692 GGGTTGGGAGAGAGGGAGGACGG - Intronic
1095679588 12:44958530-44958552 GTATGGGGAGAGGGGGACGACGG + Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096122186 12:49095220-49095242 ATGTGAGGAGAGATGGAAGTCGG - Intergenic
1096357412 12:50952866-50952888 TTGAGGGGAAAGAGGGCACAGGG - Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1096788235 12:54029991-54030013 TGGTGGGGAGCGAGGGAGAAAGG - Exonic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097195151 12:57238984-57239006 GTGTGGGGAGCGAGGAGAGATGG - Intronic
1097324948 12:58265994-58266016 TGGTGAGGAGGTAGGGAAGAGGG + Intergenic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1097603415 12:61722998-61723020 TTGTGGAGACATTGGGAAGAAGG - Intronic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1098334305 12:69386642-69386664 ATGTGGGGAGAGAGGGTATAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098877015 12:75876455-75876477 TTGTGGGGACAGGTGGAAGGGGG + Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1099905749 12:88767953-88767975 TTGTGGTGTGAGAGGTAAAAGGG - Intergenic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1101393569 12:104323993-104324015 TTCTGTGGAGAGTGGGGAGAGGG + Intronic
1101930956 12:109013832-109013854 TGGTGGGGGGAGAGGGAATGGGG - Intronic
1102220171 12:111188815-111188837 TTGTTGGAAGAGAGGGCAGCAGG + Intronic
1102541225 12:113620699-113620721 TTGTCAGGGGAGAGGGAAGGAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102808087 12:115799674-115799696 TTGGGGGGGGAGAAAGAAGAAGG + Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1104088444 12:125494930-125494952 TTCAGGGAAGAGGGGGAAGAGGG - Intronic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104962909 12:132496708-132496730 ATGTGGGGAAACAGGGAAGGAGG - Intronic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1105612859 13:21984415-21984437 TTCTGGAGAGGGAGGGAAGGAGG + Intergenic
1105669862 13:22601013-22601035 ATGTGTGGAGACTGGGAAGAGGG - Intergenic
1106342875 13:28847877-28847899 TTGGGAGGAGAGCGGGAAGGAGG + Intronic
1106353473 13:28956765-28956787 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353487 13:28956825-28956847 TGGCGGGGACAGAGGGAAGAAGG + Intronic
1106353497 13:28956885-28956907 TGATGGCGACAGAGGGAAGAAGG + Intronic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106768940 13:32943523-32943545 TTGAGGGCAGAGATGGAAGTGGG - Intergenic
1106876824 13:34083419-34083441 TTGGGGGATGAGAGAGAAGAAGG + Intergenic
1106975086 13:35201899-35201921 TTGGGGTGAGAGAGGAAACATGG - Intronic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107788483 13:43977786-43977808 GAGAGGGGAGAGAGGGAGGAAGG - Intergenic
1108423121 13:50271120-50271142 TTGGGAGGAAAGAGAGAAGAGGG + Intronic
1109184846 13:59255702-59255724 AAGTGGGGAGTGAGGAAAGAAGG + Intergenic
1109316949 13:60760976-60760998 GAGTGGGGAGATTGGGAAGAGGG - Intergenic
1109846801 13:68003921-68003943 TTGTGAGGGGGGAGGTAAGAAGG - Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1110879381 13:80552602-80552624 TGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1112297262 13:98198909-98198931 TTGTGGGGGGAGGGGGAAAGGGG - Intronic
1112937444 13:104818973-104818995 TTCTTGGGAGAGAAGGAAGATGG - Intergenic
1113179773 13:107612061-107612083 TGGGGGGGAGAGAGGGGAGTGGG + Intronic
1113179784 13:107612080-107612102 TGGGGGGGAGAGAGGGGAGGGGG + Intronic
1113251548 13:108458555-108458577 GGGAGGGGAGAGAGGGAAGGGGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113512413 13:110866762-110866784 GCGTGGGGAGAGGGTGAAGAAGG - Intergenic
1113600285 13:111563475-111563497 GTGAGGGGAGAGAGGGAAACAGG - Intergenic
1113673956 13:112195734-112195756 AGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113865275 13:113517855-113517877 TTGTGGGGAGTGTGGGTGGAGGG + Intronic
1114173500 14:20297952-20297974 TTGTGGGGAGAGTGGCAGGAGGG + Intronic
1114257999 14:21018726-21018748 TTGGGGTGAGTGAGGGAGGAGGG - Intronic
1114878038 14:26747683-26747705 TTGTGGGGAGAGGGTAAAGCAGG + Intergenic
1115157962 14:30361631-30361653 TTGGAGGAAGAGGGGGAAGAAGG + Intergenic
1115314175 14:32008855-32008877 ATGGAGGGAGAGAGGGAAGGAGG - Intronic
1115378249 14:32703159-32703181 TTGGAGGCAGAGTGGGAAGAAGG + Intronic
1115730271 14:36260956-36260978 ATGTGGGGAGAAATGGAAGGTGG + Intergenic
1115871878 14:37813792-37813814 ATGTGGGGTGTGAGGAAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1116064502 14:39965513-39965535 TTGTGGGGAGAAAGATAATATGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1116947475 14:50849047-50849069 TTGTGGAGAGAAAGGGGACAAGG - Intergenic
1117217423 14:53566016-53566038 GATTGGGGAGAGATGGAAGAAGG + Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1117402793 14:55372717-55372739 TTGGAGGGAGGGAGGAAAGAAGG - Intronic
1117521183 14:56552851-56552873 TGGCAGGGAGAGAGGGAGGATGG - Intronic
1118075278 14:62291472-62291494 TTGGAGGGGGAAAGGGAAGAAGG - Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118636217 14:67750965-67750987 TTGTGGGGAGCAAGGGATAAAGG + Intronic
1118653157 14:67919393-67919415 TTTAGGGGAGAAAGGGAGGAGGG - Intronic
1118762893 14:68891287-68891309 TTGTGGGGACAGGGTCAAGAAGG + Intronic
1118817857 14:69325443-69325465 TTCTGGGGAAACAGGGACGAGGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118888518 14:69887412-69887434 TTTTTGGGGGAGAGGGAGGATGG + Intronic
1119295588 14:73530434-73530456 TAGTGGGGAGAGTGGGATTAGGG + Intronic
1119299236 14:73558162-73558184 TAGTGGGGAGAGTGGGATTAGGG + Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1120368496 14:83602374-83602396 TTGTGGGGAGGGAGGGCATCAGG - Intergenic
1121163847 14:91772604-91772626 GATTGGAGAGAGAGGGAAGAAGG + Intronic
1121227733 14:92333806-92333828 TTGTGGGGTGCGGGGGGAGAGGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121651814 14:95564367-95564389 TTGTGGGGTCAGAGTGATGATGG + Intergenic
1121665737 14:95670802-95670824 TGGTGGAGAGAGAGGTGAGAAGG - Intergenic
1121688902 14:95860629-95860651 GGGTGGGGAGAAAGGAAAGAAGG + Intergenic
1121800190 14:96768628-96768650 TGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1121828404 14:97029238-97029260 AGGGAGGGAGAGAGGGAAGAGGG - Intergenic
1122014001 14:98777887-98777909 TTGTGGGGAATGTGGGGAGAGGG + Intergenic
1122422851 14:101588378-101588400 TTGTGGGGAGGGAGGGGGAAGGG - Intergenic
1122723075 14:103732844-103732866 TTGTGGGGATAGGGGGCAAATGG - Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1123910600 15:24963079-24963101 TAGTGGGGAGAGAGGAAGGGAGG + Intronic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124597905 15:31106101-31106123 TTGTGGGGAAAGAAGAATGAGGG - Intronic
1124681777 15:31738207-31738229 GGATGGGGAGAGAGGGAGGAGGG + Intronic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1126612676 15:50545454-50545476 ATGTTGGGAGAGAGGGAGGGAGG - Intronic
1127351915 15:58161530-58161552 TTTTGGTGAGAGAGGGAAAGCGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127513385 15:59666247-59666269 TTTTGGGGAGCAGGGGAAGAAGG - Intronic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127856771 15:62960017-62960039 CTGTGGGGAGAGGGGGATGGGGG + Intergenic
1127873331 15:63091144-63091166 GGGTGGGGTGAGAGGGAAGCCGG - Intergenic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128557456 15:68641434-68641456 TTTGGGGGAGAGAGGAAAGAAGG + Intronic
1128699863 15:69796302-69796324 TTGTGAGAAGAGATGGAAGAAGG + Intergenic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1129286599 15:74530319-74530341 TTGTGGGGAGAGAGATGAAAGGG + Intergenic
1129351769 15:74959462-74959484 ATGCGGGGAGTGAGGGAGGAAGG + Intronic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129879557 15:78997885-78997907 GGGTGGGGAGAGAGGAAAGAAGG + Intronic
1130012206 15:80160560-80160582 TGGTGGGGGGAGATGGAGGAGGG + Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130455860 15:84106522-84106544 TTGTGGGGGGAGAGGGCCTATGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1130658783 15:85813490-85813512 TGGTGGAAAGAGTGGGAAGAGGG - Intergenic
1130705811 15:86232048-86232070 TGGTGGGGTGAGAGAGAGGAAGG + Intronic
1130721006 15:86386056-86386078 GGGAGGGGAGAGAGGGAGGAGGG - Intronic
1130961093 15:88659145-88659167 GTGTGGGGAGAGAAGGGACAAGG - Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131152195 15:90054179-90054201 ATGAGGGGAGAGATGAAAGAGGG + Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131177883 15:90221247-90221269 TGGTGGGCAGAGAAGGAAGCTGG - Intronic
1131204037 15:90426489-90426511 TTGTGGGGGGACAGGGTAGGGGG - Intronic
1131305666 15:91240927-91240949 TAGTGAGGAGAGAGGGAGAATGG - Intronic
1131479887 15:92771664-92771686 TTGTGGGGTTAGAAGCAAGATGG + Intronic
1131660099 15:94505194-94505216 TGGAGGGGAGAGGTGGAAGAGGG - Intergenic
1131765881 15:95675414-95675436 TGGCGGGGAGAGTGGGAGGACGG - Intergenic
1131860840 15:96651688-96651710 TTGAGGAGAGAGAAGAAAGAAGG + Intergenic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132186440 15:99805964-99805986 TTGAGGGGTGACAGGGAAGGTGG + Intergenic
1132279155 15:100597725-100597747 TTGTGGGGGCAGATGGAAAAGGG - Intronic
1132429238 15:101746746-101746768 TTGAGGGGTGACAGGGAAGGTGG - Intergenic
1132484830 16:185402-185424 TTGGGAGGAGGGAGGGAGGAGGG + Intergenic
1132561092 16:594330-594352 TTGTGGGGAGAAACGGAGGGAGG + Intronic
1133036229 16:3035818-3035840 TTCTGGGAAGAGAGGGGACAGGG - Intronic
1133839289 16:9394109-9394131 TGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1133843122 16:9428492-9428514 TTGCTGGGAGTGAGGGAAGCAGG + Intergenic
1133883759 16:9807229-9807251 GTGGGGGGAGAGAGGGAGGGAGG + Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134729604 16:16450089-16450111 TTGTGGTGGGATAGGGATGAGGG + Intergenic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134813784 16:17189176-17189198 TGGTGTTGAGAGAAGGAAGAAGG + Intronic
1135013334 16:18903469-18903491 TAGTGGTGGGAGAAGGAAGAAGG - Intronic
1135438690 16:22448147-22448169 TAGTGGTGGGAGAAGGAAGAAGG + Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136119767 16:28125014-28125036 TCGAGGGGAGAAAGGGAGGAGGG + Intronic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136330489 16:29572763-29572785 TAGTGGTGGGAGAAGGAAGAAGG - Intergenic
1136694874 16:32069592-32069614 TTATGGAGAGAGAGAGAGGAAGG + Intergenic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137074325 16:35943701-35943723 TTCTGGGGATAGAGCCAAGATGG + Intergenic
1137488290 16:48909665-48909687 TTCTGGAAAGAGAGGGAAGGAGG + Intergenic
1137616323 16:49849644-49849666 TTGAGGGGGGTGAGGCAAGAGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137800970 16:51261947-51261969 AAGAAGGGAGAGAGGGAAGAAGG - Intergenic
1137892952 16:52181440-52181462 TTGTGAGGTAAGAGGGAACAAGG + Intergenic
1137919361 16:52471622-52471644 TTGAAGGGAGAGAGGGAGAAAGG + Intronic
1138209036 16:55147450-55147472 TTGTGGGGAGAGGAGGAAAGAGG + Intergenic
1138297895 16:55902326-55902348 TTGTGGGGGGAGAGTGGGGATGG - Intronic
1138306671 16:55983170-55983192 TTGTGGGGGCAGAGGGTATATGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139353003 16:66349265-66349287 TAGTGGGGAGAGTTGGAGGAGGG + Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139975430 16:70806391-70806413 TTGTGGGGAGGTACAGAAGAAGG + Intergenic
1139976793 16:70818579-70818601 TCACGGGGAGAGAGGGAGGAAGG + Intronic
1140109794 16:71994262-71994284 TTGAGTAGAGAGAGGGAAGTGGG - Intronic
1140280576 16:73550878-73550900 TTTTGGGGAGAGAGGGGAATAGG + Intergenic
1140620238 16:76720880-76720902 TTGCGGGAAGAGTGGGAAGGGGG + Intergenic
1140933984 16:79653689-79653711 TTGTAGGGAGAGATAGAAGCCGG + Intergenic
1141105716 16:81232059-81232081 ATGTGGGGAGAATGGGATGAGGG - Intergenic
1141188760 16:81808368-81808390 TTTTAGAGAGAGAGGGAGGAGGG + Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141292062 16:82727455-82727477 TCCTGGGTAGAGAGGGAATAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141593204 16:85082109-85082131 TTGTCAGGAGAGTGGGCAGATGG + Intronic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141728378 16:85805863-85805885 TGGTGAGTAGAGAGGGAGGAAGG + Exonic
1141929117 16:87189350-87189372 GTCTGGGGAGAGCGGGAAGTGGG + Intronic
1141999928 16:87658536-87658558 TTGGGGAGAGAGAGAGAAGGGGG - Intronic
1142024449 16:87804947-87804969 ATGTGGAGAGAGAGGGCGGATGG + Intergenic
1142074574 16:88110064-88110086 ATGTGAGGAGTGAGGGAAAAAGG - Intronic
1142090872 16:88208521-88208543 TGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1203097630 16_KI270728v1_random:1274514-1274536 TTATGGAGAGAGAGAGAGGAAGG + Intergenic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1143152386 17:4815682-4815704 TGGGAGGGAGAGAGGAAAGATGG - Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143295526 17:5868896-5868918 TTGTGGGGAGAATGGGATCAAGG + Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143565506 17:7717930-7717952 TTGTGGAGGGAGAGGGAGCAAGG + Exonic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143714767 17:8758859-8758881 GTCTGGTGAGAGAGGGAGGAAGG + Intergenic
1144161112 17:12559255-12559277 AGGGAGGGAGAGAGGGAAGAAGG - Intergenic
1144169011 17:12640641-12640663 TAGTGGGGAAAGGGGGAAGGTGG + Intergenic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144350278 17:14388595-14388617 AGGTGGGGATAGAAGGAAGAGGG + Intergenic
1144482579 17:15639883-15639905 TTCTCAGGAGAGTGGGAAGAGGG - Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1144916104 17:18725148-18725170 TTCTCAGGAGAGTGGGAAGAGGG + Intronic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145868347 17:28255039-28255061 TTATGGGGAGGGAGGAAAGGTGG + Intergenic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146501498 17:33368743-33368765 TGGTGAGGAGAGAGGAAAGATGG - Intronic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147169204 17:38608412-38608434 TTTGGGGAAGAGAGGGCAGAAGG - Intergenic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147623291 17:41882695-41882717 GTGTGGGGAGAGGTGGTAGAAGG - Intronic
1147748091 17:42708269-42708291 TTGTGGGGAGGGTGTGGAGATGG + Intronic
1147878639 17:43639571-43639593 GTGAGGGGAGAGAGGGAGGCAGG - Intergenic
1148068512 17:44891839-44891861 TTGTTGGGAGTGAGGGCAGGTGG - Intronic
1148192228 17:45687663-45687685 TGCTGGGGAGAGATGGAAAAGGG + Intergenic
1148768168 17:50051481-50051503 GTGTGGGGCGAGAGGGATGCTGG - Intergenic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1148977535 17:51542803-51542825 GTGTGGGGAGACATGGGAGAAGG - Intergenic
1149588392 17:57809180-57809202 GAGTGGGGAGAGAGGGAGGCAGG + Intergenic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1149658567 17:58323079-58323101 GTGTGGGGAGAGGGGGAATGTGG - Intronic
1149920324 17:60652132-60652154 TAGTAGGGAGAGAGAGATGAAGG - Intronic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150714907 17:67563867-67563889 ATGTGGGGAGAGAGAGAAATGGG + Intronic
1151157850 17:72139224-72139246 TGGTGGGGAGAGAGTGAGAAAGG + Intergenic
1151267704 17:72969345-72969367 TTCAGGGGAGAGAGGAGAGAGGG + Intronic
1151315661 17:73320596-73320618 TTGTGGGGAGAGTGAGGAAAAGG + Intergenic
1151327813 17:73389713-73389735 TGGGGAGGGGAGAGGGAAGATGG + Intronic
1151376820 17:73694837-73694859 ATGTGGAGAGAGAGGGCAGCTGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151441502 17:74132305-74132327 TTGTGAGGAGGGAGGGAAAGAGG + Intergenic
1151452042 17:74203843-74203865 TTCGGGGGAGAGCGGGAAAACGG + Intronic
1151578712 17:74965556-74965578 TTGTGGGGAAAAGGGGAAGGGGG - Intronic
1151622105 17:75252460-75252482 GGATGAGGAGAGAGGGAAGAAGG - Intronic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1151762503 17:76113818-76113840 TGGTGGGGAAAGAGGGAGAAGGG + Intronic
1151963900 17:77421379-77421401 TTGTGGGGAGAGGCGGCAGGGGG - Intronic
1151980656 17:77506575-77506597 TGTGGGGGAGAGAGGCAAGAAGG + Intergenic
1152022822 17:77789925-77789947 ATGTGGGAAGAGAGGGCCGATGG + Intergenic
1152103911 17:78318056-78318078 TGAGGAGGAGAGAGGGAAGAAGG + Intergenic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153098842 18:1440740-1440762 TTGTGGGGAGATAGGAAAAAAGG + Intergenic
1153103065 18:1496764-1496786 TTGTTCTGAGAGAGGGTAGAGGG + Intergenic
1153223134 18:2879114-2879136 ATGTCGGGGGAGAGAGAAGATGG + Intronic
1153339922 18:3963095-3963117 TTGTGGGGAGAGCAGGATGGGGG + Intronic
1153447710 18:5192784-5192806 TGGTGGGGTGAGGGGGAAGGGGG + Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154193842 18:12252064-12252086 TGGTGGGGAGAGGTGGGAGAGGG - Intergenic
1154411142 18:14142912-14142934 TCCTGGGGAGAGAGTGGAGAGGG - Intergenic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1155029453 18:21971603-21971625 TTTTTGGGAGACAGGGAAGAGGG - Intergenic
1155412693 18:25563836-25563858 TGGCGGTGGGAGAGGGAAGAAGG - Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155620149 18:27768975-27768997 TGGTGAGGAGAGAGGGAGGGAGG - Intergenic
1155949539 18:31895413-31895435 TGGTGGGGAGAGGGGGCAGGTGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156285878 18:35695436-35695458 TTATGGGCTGAGAGTGAAGAAGG + Intronic
1156448183 18:37252123-37252145 TTGAGGGGAGACTGGGAAGCTGG + Intronic
1156460399 18:37318455-37318477 TTCTGGGGAGAAGGGGAAGGGGG - Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1156540918 18:37909449-37909471 TTGTGGGGAGAGAAGGAGGAAGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157279364 18:46335570-46335592 GAGTGGGGAGAGGGGGAGGAGGG - Intronic
1157298247 18:46461334-46461356 TTCTGAGGAGAGAAGAAAGAGGG + Exonic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157340550 18:46774014-46774036 GTGTGGGGGGAGGGTGAAGAGGG - Intergenic
1157625196 18:49045146-49045168 GGGTGGGGAGAGAGGGGACAGGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158153122 18:54394469-54394491 AGGGAGGGAGAGAGGGAAGAAGG - Intergenic
1158292779 18:55960047-55960069 TTGTTGGAAGAGAAGGGAGACGG + Intergenic
1158490717 18:57907265-57907287 GTGTGGGGAGAGGGAGAAGGAGG - Intergenic
1158581896 18:58691163-58691185 TAGTGGGGAGAGGGGACAGAAGG - Intronic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1160161277 18:76472957-76472979 ATGTGGGGAGAGGGAGGAGATGG + Intronic
1160243870 18:77141937-77141959 TTGTGGGGGGAGGGGCAAAAGGG - Intergenic
1160622111 18:80178897-80178919 TTCTGGGGAGGGAGTGAGGAAGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161093872 19:2377548-2377570 GAGAGGGGAGAGAGGGGAGAGGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161273402 19:3402875-3402897 TGAGGGGGAGAGAGGGAAGAGGG + Intronic
1161323874 19:3653692-3653714 TTCTGGGGAGAGAGGGGGGCTGG - Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161493724 19:4576321-4576343 TGGAGGGGAGAGTGGGAGGAGGG - Intergenic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162028472 19:7907263-7907285 GTGTTGGGAGAGAGAGTAGATGG + Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1163160929 19:15463864-15463886 TTAGGGGGAAAGAGGGAACAGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163741250 19:19014390-19014412 TTGTGGGGTGTGAGGGTGGAAGG + Intronic
1163741706 19:19018102-19018124 TTGTGGGGTGTGAGGGTGGAAGG - Intronic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164441627 19:28284042-28284064 TGGTGGTGAGAGAGGGTTGAAGG - Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164491502 19:28719219-28719241 TTATGGAGAGAGAGGATAGAAGG + Intergenic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164828947 19:31305613-31305635 TTGTGGATAGAAAGAGAAGAGGG + Intronic
1164833743 19:31343115-31343137 TTGTCGGGAGGGAGGGCACAAGG - Intronic
1164916774 19:32058315-32058337 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1165407805 19:35641780-35641802 ATGGGGGGAGTGAGGGGAGAGGG - Exonic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165771077 19:38380657-38380679 TTGGGGGGAGGGAGGGAGGGAGG + Intronic
1166347540 19:42175954-42175976 ATGGGGGGGGAGAGGTAAGAGGG - Intronic
1166622004 19:44309488-44309510 TTGTGGGGTGAGAACCAAGATGG + Intergenic
1166700263 19:44878202-44878224 TTCTGAGGAGAGAGAGAAGGAGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166976283 19:46606985-46607007 TTGAGGGGAGAAAGGAGAGAAGG - Intronic
1167199843 19:48056981-48057003 TTGGGTGGAGAGCGGGAGGAAGG + Intronic
1167607956 19:50491514-50491536 TTGTGGGGTGAGGGAGAAAACGG + Intergenic
1167631024 19:50626246-50626268 GTGAGGGGAGAGAGAGAGGAGGG + Intronic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1167709096 19:51099141-51099163 TGGTGGGGAGAGAAGGGAGCGGG + Intronic
1167781348 19:51601187-51601209 TGGTGGGGAGAGACGGGAGAGGG - Intergenic
1167992736 19:53374210-53374232 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
1168083784 19:54029964-54029986 GGGAGGGGAGAGAGGGGAGAGGG + Intergenic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168252084 19:55147032-55147054 GTGTGGGGAGAGAGGAGGGAGGG + Intronic
1168456251 19:56511018-56511040 TGGTGGGGATTGAGTGAAGAAGG + Intronic
1168474673 19:56667316-56667338 TGGTGCTGAGAGAGGGAAGGAGG + Intronic
1168515332 19:57006078-57006100 TGGTGGGGAGAGAGATAGGAGGG + Intergenic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
1202697455 1_KI270712v1_random:135398-135420 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
925036848 2:693528-693550 TTGTTGAGAGAGAAGGAAGGCGG - Intergenic
925053574 2:836294-836316 TTGAGGGGAGAAAAGGATGAGGG + Intergenic
925513614 2:4654612-4654634 TTGTCGGGGGACAGGGAAGAAGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925578246 2:5382826-5382848 TGGGGAGGAGAGAGAGAAGATGG - Intergenic
925876688 2:8317326-8317348 TTTTCAGGAGAGAGGGAACATGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926179405 2:10627735-10627757 TTTTGGAGAGAGAGGGAGGGAGG + Intronic
926370834 2:12177276-12177298 GTGTGGGGAGGGAGGGCACACGG - Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
926918459 2:17915897-17915919 TTGTGGGGAGGGAGAGAGAAAGG + Intronic
926981965 2:18582427-18582449 GTGTGGGGAGAGAGAGCAGCCGG + Intronic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927578883 2:24223767-24223789 GGGAGGGGAGTGAGGGAAGAAGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
928200730 2:29246214-29246236 GGAGGGGGAGAGAGGGAAGAAGG + Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929107793 2:38380948-38380970 TTGTAGGGACAGAGGGAAATCGG + Intergenic
929310039 2:40413043-40413065 GTGTGAGGTGAGAGGGAGGAGGG - Intronic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931389961 2:61833054-61833076 TGGTGGGGAATGAGGGAAGGTGG + Intronic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931472188 2:62549422-62549444 TTTTAGGGAGAGATGGCAGATGG - Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
931899737 2:66774507-66774529 TTGTGGGGGGAAAGAGAAGGAGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932307923 2:70716935-70716957 TTATGGGGAGACAGAGAGGAAGG + Intronic
932310455 2:70735580-70735602 TTGTTAGGAAAGAGGGAGGAGGG - Intronic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
933158017 2:78995191-78995213 AAGTGGGGAGAGAATGAAGATGG - Intergenic
933191535 2:79339117-79339139 CTGTAGGGAGAGAGTGAACAGGG + Intronic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933831945 2:86218294-86218316 TGGTGGGGAGAGAGTGAGCAGGG - Intronic
934278625 2:91592422-91592444 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
934571255 2:95374667-95374689 AGGTGGGGTGAGAGGGAGGAGGG - Intronic
934710504 2:96511120-96511142 TTGTGGGGAGGGGGGCAGGAAGG + Intergenic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
934761607 2:96859883-96859905 GTGAGGGGAGAGAAGGGAGAGGG - Exonic
935104283 2:100025191-100025213 TTTTGGGGAGTGAGGAAGGAAGG - Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936024762 2:109022604-109022626 TGGGAGGGGGAGAGGGAAGAGGG + Intergenic
936329497 2:111535560-111535582 TTGTAGGTAGACAGGGCAGAAGG + Intergenic
936521274 2:113213334-113213356 TAATGGGGAGAGGGAGAAGAGGG + Intergenic
936846789 2:116844279-116844301 GAGAGGGGAGAGAGGAAAGAAGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937293769 2:120797719-120797741 GGGAGGGGAGAGAGGGAGGAGGG + Intronic
937293775 2:120797735-120797757 AGGAGGGGAGAGAGGGAGGAGGG + Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
938539210 2:132272765-132272787 TTGGGGGGAGGGGGGGAGGAGGG - Intergenic
938634698 2:133211041-133211063 TTGAGAGGAGTGAGGGGAGAAGG - Intronic
938671190 2:133588390-133588412 AGGGAGGGAGAGAGGGAAGAAGG - Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939430590 2:142100915-142100937 ATGAAGGGAGAGAGGGAAGGAGG + Intronic
939495809 2:142926543-142926565 TTATGGGGTGATAGGGAAGAAGG + Intronic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940335583 2:152523945-152523967 TTATTGGCAGAGAGGGCAGAAGG + Intronic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941163033 2:162056549-162056571 TTGTGAGGTTAGAGGCAAGATGG - Intronic
941195446 2:162445203-162445225 TGTTGGGGAGAGAAGGAAGTTGG + Intronic
941536505 2:166728712-166728734 TGATGGCTAGAGAGGGAAGATGG + Intergenic
941748234 2:169109808-169109830 TTGCGGGGAGGGATGGAAGTGGG - Intergenic
942345312 2:174996745-174996767 TTGAGGAGAGAGAGGAGAGAGGG - Intronic
942516125 2:176755249-176755271 TGACAGGGAGAGAGGGAAGAAGG + Intergenic
942526323 2:176856733-176856755 TTCAGGGGACAGAAGGAAGAGGG - Intergenic
942543965 2:177043616-177043638 TTTTGGGGAGAGAGGGAGAAAGG - Intergenic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943069709 2:183126024-183126046 AGGGAGGGAGAGAGGGAAGAAGG - Intronic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943394439 2:187315589-187315611 TGGTGGGGCGAGAGGGAACAGGG - Intergenic
943434884 2:187852768-187852790 GTGTTGGGAGAGAGGGTATATGG - Intergenic
944454033 2:199875135-199875157 TTTAAAGGAGAGAGGGAAGATGG + Intergenic
944511309 2:200468807-200468829 TTGTAGAGAGAGATGGAAGTTGG - Intronic
944621147 2:201517173-201517195 TGGTGGGGAGGTGGGGAAGAAGG - Intronic
944663007 2:201936819-201936841 TTGTCAGAACAGAGGGAAGAGGG + Intergenic
944837567 2:203595046-203595068 GTGTGGGGATAGGGGGAATATGG + Intergenic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945108212 2:206337164-206337186 TTCTTGGGAGTGAGGGAAGCAGG + Intergenic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945224464 2:207519397-207519419 TTATGGGGAAAGAGGGAGGAAGG - Intergenic
945452151 2:210005903-210005925 TTGTTGGGAGATAGGGTAAATGG + Intronic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946165926 2:217863829-217863851 GTCTGGGGATAGAGGGAGGAAGG + Intronic
946346519 2:219115416-219115438 TTATGGTGAGAGACGGTAGAGGG + Intronic
946397375 2:219449668-219449690 TGTTGGGGAGAGATGGTAGATGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946666958 2:222060471-222060493 TCATGGGCAGAGAGGGAAGGAGG + Intergenic
947749476 2:232525042-232525064 TGGTGGGGAGAGTGAGTAGAGGG + Intronic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948131123 2:235601275-235601297 GGGTGGGGAGAGAGGCGAGAAGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948406928 2:237728817-237728839 TTGGTCGGGGAGAGGGAAGAAGG - Intronic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
948912619 2:241011970-241011992 GGGTGGGGAGAGAGGAAAGCTGG + Intronic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1168953501 20:1818452-1818474 TTGTGGGGGGAGAGGTGGGAGGG - Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169410774 20:5367899-5367921 TTGTGAGGTTAGAGGCAAGATGG + Intergenic
1169689253 20:8311978-8312000 TTGAGCAGTGAGAGGGAAGAGGG - Intronic
1169882030 20:10357313-10357335 GTGGCAGGAGAGAGGGAAGAAGG + Intergenic
1169922899 20:10754444-10754466 TTGCGTAGAGAGAGGGAGGAGGG + Intergenic
1170007047 20:11680768-11680790 TTGTGGGCAGATAGGGAGGGAGG + Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170604042 20:17862830-17862852 TTATGGTGAGAAAGGGAGGAAGG + Intergenic
1171194629 20:23187451-23187473 TTTAGGGGAGAGAGGGAAATGGG + Intergenic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1172116245 20:32575081-32575103 TTCTGTGGTGAGAGGCAAGAGGG - Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173367600 20:42401254-42401276 TGGTGGAGAGTGAGGGAAAAGGG - Intronic
1173608866 20:44352130-44352152 TGGTGGGGGGAGAGGGGAAATGG - Intergenic
1173638734 20:44584021-44584043 ACTTGGGGAGAGAGGAAAGAAGG + Intronic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174303627 20:49600100-49600122 TTGTGGGGAATGGGGGACGAGGG - Intergenic
1174560574 20:51428091-51428113 AGGAAGGGAGAGAGGGAAGAAGG + Intronic
1174758399 20:53182291-53182313 TTGAAGGGAGAGAGGGAGGGAGG - Intronic
1175157210 20:56979182-56979204 TTGTGGGGCGCGTGGGGAGAAGG + Intergenic
1175245031 20:57577095-57577117 ATGTGGGGAGAGTGGGTAGATGG - Intergenic
1175369940 20:58481523-58481545 TTTTGAGGAGAGAGGGATGGAGG + Intronic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175487291 20:59355448-59355470 GAGAGGGGAGAGAGGGGAGATGG - Intergenic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175507005 20:59493270-59493292 TGGGAGGGAGCGAGGGAAGAAGG - Intergenic
1175563849 20:59956549-59956571 TGGGGGGAAGAGTGGGAAGAGGG - Intergenic
1175699835 20:61128934-61128956 TTGATGGCAGAGATGGAAGAGGG + Intergenic
1175774995 20:61647579-61647601 TTGTGAGGAGAGAGAGGAGAGGG - Intronic
1175973998 20:62701381-62701403 TGGTGGGGGGAGAGGAAGGAGGG - Intergenic
1175984149 20:62755693-62755715 ATGGAGGGAGAGAGGGATGATGG - Intronic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1176861913 21:14015503-14015525 TCCTGGGGAGAGAGTGGAGAGGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1177674372 21:24277308-24277330 GAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1177774085 21:25549092-25549114 GTCTGGGGAGAGTGGGAAGCAGG - Intergenic
1177809326 21:25908526-25908548 TTCTGGGGAGAGGTGGGAGACGG + Intronic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178352602 21:31883555-31883577 TAATGGGGAGCGAGGGAAGGTGG - Intronic
1178719710 21:34997835-34997857 TGTTGGGGAGAGAAGGATGATGG - Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179134582 21:38668398-38668420 TTGTGGGGAGAGATAAAGGAAGG + Intergenic
1179336923 21:40465285-40465307 TTGTGGGGAGAGAGAAAAGCAGG - Intronic
1179478043 21:41660279-41660301 TGGTGGGGAGTGGGGGCAGAGGG - Intergenic
1179623354 21:42633084-42633106 TGGTGGGCAGAGATGGAGGACGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180798744 22:18621400-18621422 TTGTGGGAAGCGAGGGATGTGGG + Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181222970 22:21373862-21373884 TTGTGGGAAGCGAGGGATGTGGG - Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181255769 22:21561757-21561779 TTGTGGGAAGCGAGGGATGTGGG + Intronic
1181295266 22:21833186-21833208 TTTTCGGGAGTGAGCGAAGACGG - Intronic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181540172 22:23568830-23568852 TTGTGGGGAGAGGAAGGAGATGG - Intergenic
1181945046 22:26510008-26510030 TTTAGGGAAGAGGGGGAAGATGG - Intronic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182150855 22:28026176-28026198 TTGAGGGCAGAGGGGGAAGGGGG + Intronic
1182332192 22:29559018-29559040 TTTAGGGGACAGTGGGAAGAGGG - Intronic
1182420956 22:30248345-30248367 GTGTGGGGTGAGAGGCAGGAAGG - Intergenic
1182641467 22:31771327-31771349 TTGTGGGGAGCCAGGTAAAATGG + Intronic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1182994274 22:34798555-34798577 TGGAGGGGAGCGAGGGAAGCAGG + Intergenic
1183336911 22:37254045-37254067 TATGGGGGAGAGGGGGAAGAGGG + Intergenic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183502845 22:38191402-38191424 CTGTGGCGAGACAGGGAGGAAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184310330 22:43637157-43637179 TTCTGGGGAGATAGGGAGGCAGG - Intronic
1184421449 22:44384901-44384923 GAGTGGGGGGAGATGGAAGAGGG + Intergenic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184941248 22:47767072-47767094 TTGTGGTGAGAGAGAACAGAAGG - Intergenic
1185202469 22:49516670-49516692 TGGGAGGGAGAGAGGGAGGAGGG + Intronic
1185212364 22:49577476-49577498 CTGTGGGGAGAGAGGGACTGTGG - Intronic
1185415959 22:50710381-50710403 AGGTGGTGAGAGAGAGAAGAGGG + Intergenic
949356198 3:3182794-3182816 TGGTGGGAAGTGTGGGAAGAGGG - Intergenic
949605582 3:5649649-5649671 TTGAGGGGAGAGGGAAAAGAAGG + Intergenic
949607468 3:5670100-5670122 AGGTGGGGAGAGAGGGGATAAGG + Intergenic
949826877 3:8174874-8174896 TTGGGGTGAGAGGAGGAAGAAGG - Intergenic
949867072 3:8555124-8555146 TTGTGGGGAAATGGGGCAGAGGG - Intronic
949920506 3:8996545-8996567 GTGTTGGGAGAGAAGGAAGGAGG + Intronic
950094345 3:10319983-10320005 GAGTGGGGAGAGAGGGAGGGTGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950478905 3:13232574-13232596 GTCTGGGGAGAGAGGGCAGGGGG + Intergenic
950883658 3:16344490-16344512 TAGTTGGGCGAGGGGGAAGAAGG - Intronic
950950382 3:16992497-16992519 TTGTGGTGAGATAGGTGAGAAGG + Intronic
950955072 3:17044226-17044248 TTCTGGAGAGTGAGGGAGGAAGG + Intronic
951101889 3:18698219-18698241 ACGTGGGGAGAGAGGGACCAGGG + Intergenic
951171545 3:19547752-19547774 TTGAAGAGAGAAAGGGAAGAGGG - Intergenic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
951781180 3:26364448-26364470 TTTTGGAGAGAGAGGCAACAGGG - Intergenic
952155769 3:30641910-30641932 ATGTAGGGAGAGAGAGAGGAAGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952722666 3:36549423-36549445 TGGTGAGGAGACAGGGAAGGAGG + Intergenic
952869053 3:37881821-37881843 TTTTGGAGAGAGAGGAAAGGAGG + Intronic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
952971481 3:38653564-38653586 TTGAGGTGAGAGATTGAAGAAGG + Intergenic
953005770 3:38977924-38977946 TGGTGGGGAGAGGCTGAAGATGG - Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953436982 3:42885439-42885461 TTGTTGGGGGAAAGGGAATAGGG + Intronic
953661370 3:44894027-44894049 TGGTGGGGAGAGAGTCAAGGGGG - Intronic
953668392 3:44942482-44942504 TCCTGGGGAGAGAGGCAAGGAGG + Intronic
954059890 3:48058270-48058292 TTGTACGGAGAGAGGGAGGGAGG + Intronic
954425526 3:50440951-50440973 TTGTGGGTGGACAGGGACGAGGG + Intronic
954927688 3:54251214-54251236 TTGGGGTGAGAGAGGAAAGCAGG + Intronic
955502453 3:59598597-59598619 TGGTGGAGAGACAGGGCAGAGGG + Intergenic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955756629 3:62231282-62231304 TTCTGGGGAGAGAGGAGAGAAGG + Exonic
955977245 3:64490494-64490516 TGGGGGGAAGAGAGAGAAGAAGG + Intergenic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956173785 3:66454523-66454545 TTGTGGGGAGAGATGGGCGTCGG - Intronic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956455362 3:69415459-69415481 TAGAGGGCAGAGGGGGAAGAGGG - Intronic
956473037 3:69588867-69588889 GTGTGGGGAGAGTGGGAAAGTGG - Intergenic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
957597499 3:82287176-82287198 TTGGGAGGAGCCAGGGAAGATGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958874536 3:99601020-99601042 TTGTGGGGAGAGGGGACACAGGG + Intergenic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
959539594 3:107523930-107523952 ATAGGGGGAGAGGGGGAAGAGGG + Intronic
959633933 3:108540315-108540337 TGGTGGAGAGAAAGGGAACATGG - Intergenic
959648885 3:108732462-108732484 TGGTGGGGAGAGAGGAAACTGGG + Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960812349 3:121636965-121636987 GTGAGGGGAGAGAGGAGAGATGG - Intronic
961012404 3:123445231-123445253 GGGTGGGGAGAGAAGGGAGAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961602060 3:128069985-128070007 TTGTGGGGAAACAGGTGAGACGG - Exonic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
961811948 3:129527191-129527213 TTGTGGGGTGAGGGGGCACAGGG - Intergenic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962462888 3:135630911-135630933 TGGTGGGCAGAGAGTGCAGAGGG + Intergenic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964389367 3:156181717-156181739 GTGTGGGGAGAAATGGAAGGAGG + Intronic
964574636 3:158151484-158151506 TTCAGGGGAGAAGGGGAAGAGGG + Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964691669 3:159456598-159456620 TTTGGGGGACAGAAGGAAGAGGG + Intronic
965210630 3:165782320-165782342 TTTTGGGGAGATAGAAAAGATGG + Intronic
965291392 3:166886274-166886296 TAGTGGGGAGAGAGGGATATGGG + Intergenic
965401310 3:168215985-168216007 TTGTGTGGAATGAAGGAAGAGGG + Intergenic
965684376 3:171286083-171286105 TGCTGGGGAGAGAGGGGAGAGGG + Intronic
965855569 3:173083635-173083657 TTTCGGGGAGAGAAGGAGGAAGG - Intronic
966184212 3:177213658-177213680 TGGTTGGGGGAGGGGGAAGAGGG - Intergenic
966235842 3:177700782-177700804 TCCTGGGGAGATAAGGAAGATGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966657403 3:182374781-182374803 TTTTGGAGAGAAAAGGAAGAGGG - Intergenic
966733220 3:183167956-183167978 TTGTGGGGAGGGGGGGACCAAGG - Intergenic
966906551 3:184530364-184530386 TTGTAGGGGGAGGAGGAAGATGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967186555 3:186949248-186949270 TCCAGGTGAGAGAGGGAAGAAGG + Intronic
967236573 3:187390721-187390743 TTGTGGGGAAAGGTGGGAGAGGG + Intergenic
967335459 3:188339099-188339121 TTGAGGGGAGAGAGGATGGATGG + Intronic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
967973598 3:195017471-195017493 TTGTGGGGAGAGATTGATGGTGG - Intergenic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
968259192 3:197305760-197305782 TTTGGAGGAGTGAGGGAAGATGG - Intergenic
968339268 3:197941366-197941388 GGGAGGGGAGAGAGGGAGGAAGG - Intronic
969228996 4:5816691-5816713 GGGAGGGGAGAGAGGGGAGAAGG - Intronic
969429090 4:7143350-7143372 TTGTCTGGGGAGAGGGAGGAAGG + Intergenic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969515241 4:7644094-7644116 TTGTTGGGAGATAAGGGAGAGGG + Intronic
969520713 4:7676275-7676297 AGGTGGGGTGAGAGGGCAGAGGG - Intronic
969548797 4:7850423-7850445 TGGAGGAGGGAGAGGGAAGAGGG + Intronic
969690456 4:8701439-8701461 GGGTGAGGAGAGAGGGAGGAGGG - Intergenic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969752787 4:9124772-9124794 TTGTCGGGAAACGGGGAAGAGGG + Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970110258 4:12629820-12629842 GTGGAGGGAGAGAGTGAAGAGGG + Intergenic
970174300 4:13323014-13323036 TTGTGGGGAAAAAGGTAAGCTGG - Intergenic
970329436 4:14964063-14964085 TTGTGGGGTAAGAGTGAAAAGGG - Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970553753 4:17210965-17210987 TTGTAGGGAGAGATAGAATAGGG - Intergenic
970764561 4:19532014-19532036 TTGTGGAGACAAAGGAAAGAAGG + Intergenic
970781579 4:19744173-19744195 TTATGGGGAGAGGGAGAAGAAGG - Intergenic
971653242 4:29306951-29306973 TAGTGAGGAGACAGGGAAAATGG - Intergenic
971793078 4:31194282-31194304 TTGTGGGGAGGGAAGAAAAACGG + Intergenic
971902718 4:32682687-32682709 TTGTGAGGTTAGAGGAAAGATGG - Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
972726048 4:41746995-41747017 TTGGGGGGCGGGAGGGGAGAAGG + Intronic
972789506 4:42357421-42357443 ATGGGGAGAGAGAGAGAAGAAGG + Intergenic
972945203 4:44245217-44245239 TTGGGGTAAGAGAGGGAATAGGG + Intronic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973814798 4:54609858-54609880 TCCAGGGGAGAGAGGGAATAAGG - Intergenic
973820264 4:54657256-54657278 TTGTGTGGAGACAGGGGCGATGG - Intergenic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
974646832 4:64705172-64705194 TTGTGGGGTGTGAGGGGGGAGGG + Intergenic
974664469 4:64939771-64939793 TTGTTAGGAGATAGGGAGGAAGG + Intergenic
974908066 4:68081948-68081970 TTGTTGGGGGAGTGGCAAGACGG + Intronic
975430562 4:74285187-74285209 TTGTGGGGTGAGGGGGATGGGGG + Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
975846436 4:78530212-78530234 TTAAGGGGAGAGAGGAACGACGG + Intronic
976188836 4:82469662-82469684 TTGTGAGGTTAGAAGGAAGATGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976579500 4:86719120-86719142 GAGTGGGGAGAGTGGGAGGAAGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977140725 4:93368548-93368570 TTGTGGGGAGAGGTGGGAGTGGG - Intronic
977612193 4:99047535-99047557 TTTTGGGGGGAGAAGGAAGGAGG - Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978066395 4:104408448-104408470 TGGATGGCAGAGAGGGAAGAAGG - Intergenic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978445696 4:108777960-108777982 TTGTGGGGCTAGAAGCAAGATGG + Intergenic
978522976 4:109635661-109635683 TTGTAGAGAGAGAGGGAGGGAGG - Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
978990492 4:115076080-115076102 TTGTTGGGAAAGAGGGAACAAGG - Exonic
979463978 4:121015531-121015553 TTGTGGGGAGAGCAGAAAGCTGG - Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980008775 4:127571428-127571450 TTGAGGGGAGAGAGGTGAGATGG - Intergenic
980350288 4:131675304-131675326 TGATGGGGAGAGAGGGATAAGGG + Intergenic
980544899 4:134246617-134246639 TTGTGGGGAGGGGGGGGGGAGGG - Intergenic
980620455 4:135294707-135294729 TTGTACTGAGAGAGGGAAGATGG - Intergenic
981091548 4:140737358-140737380 ATGGAGGGAGAGAGGGAACAGGG - Intronic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
981271326 4:142849501-142849523 ATGTGGGGAGAGAGAGAAAGAGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981745908 4:148052230-148052252 AGGAGGAGAGAGAGGGAAGAAGG - Intronic
982233279 4:153228871-153228893 TTGTGGGGGGAAAAGGATGAAGG - Intronic
982629693 4:157816756-157816778 TAGTGGTGAGAGAAGGTAGATGG + Intergenic
982807300 4:159782413-159782435 GTGTGGGGATAGAGGGCATATGG - Intergenic
983905550 4:173177559-173177581 TGGTGGGGAGAGATGAAAGAAGG + Intronic
984037710 4:174691373-174691395 GTGGGGAGAGAGAGGGGAGAGGG - Intronic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984043785 4:174771872-174771894 TTGTGGTGAAAGAGGCAAAATGG + Intronic
984556927 4:181225686-181225708 GTGTGGGGAGTGAGAAAAGAAGG - Intergenic
984621306 4:181955603-181955625 TTGTGGGGAGGGGAGGAACAAGG + Intergenic
985100990 4:186458486-186458508 GTGGGGGGAGGGAGGGACGAGGG - Intronic
985771974 5:1817510-1817532 TGGGAGGGGGAGAGGGAAGAAGG + Intergenic
986184243 5:5421931-5421953 TTCTCGGGAGAGAGAGAAAACGG - Intronic
986347105 5:6845890-6845912 TAGTGAGGAGAGAGGAAAGAAGG + Intergenic
986526222 5:8680242-8680264 TTTTGGGAAGAGAAGGAAGAAGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986669864 5:10133243-10133265 GTGTGGGGACAGAGGGGATAAGG - Intergenic
986677002 5:10194516-10194538 GGGTGGGGAGAGATTGAAGAGGG - Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987237726 5:15959838-15959860 TTATGAGGAGAGAGGGGTGAGGG + Intergenic
987309361 5:16667584-16667606 TCGTGCAGTGAGAGGGAAGAGGG - Intronic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988372297 5:30387149-30387171 TGGTGGGGAGAGATGGATTATGG + Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
989008575 5:36843547-36843569 TTGTGGGGAAATAGGAAATAGGG - Intergenic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989280061 5:39631001-39631023 TGGTGGAGAGAGAGGGAATGGGG - Intergenic
989502133 5:42179864-42179886 TTGAGGGTAGAGAGGAAAGAGGG + Intergenic
989730702 5:44644584-44644606 GTGTGGGGAGAGAGAAAAAAAGG + Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990058421 5:51615684-51615706 TTGTGGGGAGAGAAGTGAGATGG + Intergenic
990527045 5:56638414-56638436 TGGTGGGCAGAGCGGGAAGGTGG - Intergenic
990689170 5:58343469-58343491 GTGTGGAGAGAGTAGGAAGAGGG + Intergenic
991038667 5:62153937-62153959 GTGGGTGGAGAGTGGGAAGAGGG - Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
992492039 5:77254910-77254932 TTTTGGGGAGACAGGGAGGGTGG + Intronic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
992563606 5:77976004-77976026 TTGTAGAGTGAGAGGGAAAAAGG + Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994550164 5:101223923-101223945 GTCTGGGGAGAGTGGGGAGAGGG + Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995248966 5:109967401-109967423 GTGTTGGGAGTGTGGGAAGATGG - Intergenic
995301810 5:110593999-110594021 TTGTGGGGAGTCTGGCAAGATGG + Intronic
995478168 5:112568817-112568839 TTGCTAGGAGAGAGGGAAGGGGG + Intergenic
995624023 5:114056885-114056907 ATGAAGGGAGAGAGGGCAGAAGG + Intergenic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997212458 5:132085493-132085515 CTGTGGGGAGAGAAGCAGGAAGG - Intergenic
997258619 5:132448321-132448343 TTGTGGGGAGATAAGGAATACGG - Intronic
997340494 5:133140980-133141002 TTGGGGGGATATAGGGTAGAGGG - Intergenic
997875721 5:137544981-137545003 TTCAGAGGAGAGAGGGAAAAAGG + Intronic
998015050 5:138725114-138725136 GCCTGGGGAGAGAGGGAAAAGGG + Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998820952 5:146057343-146057365 TTGTGGGGAGAGGTGGAGGGAGG - Intronic
998988358 5:147787475-147787497 TTGTGGGGTGAAATGGAAGCAGG + Intergenic
999167180 5:149559821-149559843 TTGGGGGGAGAGAGAGAATAGGG - Intronic
999287173 5:150401008-150401030 TTGAGAGGAGAGAGGCCAGATGG - Intergenic
999312099 5:150558063-150558085 GGGTGGGGAGAGTGGGGAGAGGG + Exonic
999379011 5:151106931-151106953 GTGGGAGGAGAAAGGGAAGAGGG + Intronic
999663932 5:153893666-153893688 TTGTGAGGAGGGATAGAAGATGG - Intergenic
999699904 5:154218723-154218745 TTGGGGGGAGAGGGTGTAGATGG + Intronic
999961816 5:156764041-156764063 TTCTTGGGACAGGGGGAAGAGGG - Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000240863 5:159406823-159406845 TTGTGGGAAAAGAGAGAAGCAGG + Intergenic
1000252198 5:159506346-159506368 TTTTGTGGAGGGAGGGAAGGGGG + Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000646179 5:163762963-163762985 TTGTGGAGAGAGAGGGAGGAGGG + Intergenic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1000868851 5:166549887-166549909 TTTTGGGGAGATAGGGTTGAAGG - Intergenic
1000989683 5:167898983-167899005 TTCAGGGAAGAGAGGCAAGAGGG + Intronic
1001214902 5:169846548-169846570 TTGTGGTGAGAAAGGGAGCATGG + Intronic
1001566312 5:172701635-172701657 TTCTGGGGAGGGTGGGCAGAAGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002460164 5:179369347-179369369 GTGTGGGGACAGAGCGAAGGCGG - Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003368449 6:5500189-5500211 TTCTAGGGAGAGAGGGAGGGAGG - Intronic
1003380227 6:5618283-5618305 TGGTGGGGAGATGGGGAGGATGG - Intronic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1003694424 6:8389182-8389204 TTTAGGGGAGAGTGGGCAGATGG - Intergenic
1003869758 6:10392113-10392135 TTTTGGTGAGAGAGAGAAAAAGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004256507 6:14069286-14069308 GAGTGGGGAGAGAGAGAGGACGG + Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004396039 6:15247442-15247464 TTGAGGGGAGGGAGGAAAGGGGG + Intronic
1004563611 6:16774763-16774785 TTTTGGAGAGAGAGGTAAGTGGG + Intergenic
1004785168 6:18960531-18960553 CTTTGGGGAGAGAGAGAAAAAGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005390702 6:25330403-25330425 TTTTGGGGAGCCAGGGAAGAAGG + Intronic
1005878224 6:30032030-30032052 TTCTGGGGACAAAGGGAAGGTGG + Intergenic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1006247615 6:32753307-32753329 GTGTGGGGAGAGGGAGAAAAAGG + Intergenic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1006718302 6:36134078-36134100 TGGTGGTGAGAGAGGGAGAAGGG + Intronic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007503512 6:42316562-42316584 TTGTGAGGCTAGAGGCAAGATGG - Intronic
1007724996 6:43910790-43910812 ATATGGGGAGTGATGGAAGAAGG + Intergenic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008575582 6:52857005-52857027 TTGTGGGGAGACTTGCAAGATGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1008865215 6:56202373-56202395 TTTAGGGGAGATAAGGAAGATGG - Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009497328 6:64367490-64367512 TTTTGGAAAGAGAGGGAGGATGG + Intronic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009696057 6:67104499-67104521 TTTTGGGGAGAGAATCAAGAAGG + Intergenic
1009796766 6:68479432-68479454 TTTTTGGTAGAGAGGGCAGATGG - Intergenic
1010089627 6:71965300-71965322 TTTTTGGGAGGGAGGGTAGAAGG + Intronic
1010604490 6:77871543-77871565 TAGCAGGGAGAGAGGGAGGAGGG + Intronic
1011275944 6:85631407-85631429 GAGTGGGGAAAGAGGTAAGAAGG + Intronic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011402573 6:86979972-86979994 TTATGGGGAGAGAGTGAGAATGG - Intronic
1011446185 6:87443766-87443788 GAGTGGGGAGAGAGAGAGGAGGG - Intronic
1012535857 6:100296005-100296027 TAGGGGAGAGAGAGGGTAGAAGG + Intergenic
1012629184 6:101442256-101442278 TTGTTGGGAGAAAAGGAAAAAGG + Intronic
1012971911 6:105740111-105740133 TTTTAGGGTAAGAGGGAAGAGGG + Intergenic
1013282289 6:108649689-108649711 TTGTGGATAGAAAGGGAAGTAGG - Intronic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013401957 6:109806414-109806436 TTGTGTGGAGAGGTGCAAGATGG + Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013582795 6:111552641-111552663 AGCTGGGGAGAGAGGGGAGAGGG - Intergenic
1013663264 6:112320539-112320561 TAGTGGGGAGTGGGGGAAAATGG + Intergenic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014059431 6:117053096-117053118 TTGTGGAGGGAGATGGGAGAGGG + Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014075267 6:117228211-117228233 TTTAGGAGAGTGAGGGAAGAGGG - Intergenic
1014228582 6:118876220-118876242 TTGAAGGGAAAGAGGGATGAGGG + Intronic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014709501 6:124789938-124789960 TTGGGGGTAGAGAGGGCAGGGGG + Intronic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1015860003 6:137665833-137665855 TGGTGGTGAGATGGGGAAGACGG + Intergenic
1015890890 6:137968595-137968617 GTGTAGGGAGAGGGGGAAGGAGG + Intergenic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1015912233 6:138180480-138180502 TAGTAGGGAGAAAAGGAAGAAGG - Intronic
1015968097 6:138715287-138715309 TTGTGAAGAAAGAGGGAAGGGGG + Intergenic
1015980276 6:138831418-138831440 CTATGGAGAAAGAGGGAAGAGGG - Intronic
1016231208 6:141806631-141806653 TTCTGGGGAGAACGGAAAGAGGG - Intergenic
1016380204 6:143469953-143469975 TTCTGGGGGGTGAGGGGAGATGG + Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017279125 6:152604765-152604787 TTGTAGGGACAGTGGGAAGGGGG - Intronic
1017638844 6:156470748-156470770 TTGTGGGGAAGGAATGAAGAGGG + Intergenic
1017676094 6:156815460-156815482 GTGTGGGGAGAAAGGGAGAAAGG - Intronic
1017942674 6:159066916-159066938 TTGGGGGGAGAGAGAGAGAAGGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018207263 6:161447097-161447119 GTGTGGGGTGAGAAGGAAAATGG - Intronic
1018218433 6:161553338-161553360 GGGTAGGGAGAGAGGAAAGAAGG - Intronic
1018747440 6:166773250-166773272 GGGTGAGGAGAGGGGGAAGAGGG + Intronic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019195337 6:170278406-170278428 GTGGGGGGAGAGAGGAAGGAAGG - Intergenic
1019219864 6:170464744-170464766 TTGTGAGCAGAGTGGGAGGAAGG - Intergenic
1019427455 7:984303-984325 GGGTGGGGACAGAGGGAAAATGG - Intronic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019762885 7:2826776-2826798 TTGAGGGGAGACAGGGAAGGAGG + Intronic
1020129049 7:5549170-5549192 AGGGAGGGAGAGAGGGAAGAAGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020891402 7:13882393-13882415 TTGTGGGGAGAGAGTGAACACGG + Intergenic
1021006247 7:15397599-15397621 AGGTGGGGAGAAAAGGAAGAAGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021279039 7:18694331-18694353 TTGTGAGGAGAGAGGGACAAAGG - Intronic
1021449376 7:20768647-20768669 TTGAGGGGAGAGAAGGGAAAAGG - Intronic
1021667774 7:23003524-23003546 TGTTTGGGAGAGAGGAAAGAGGG - Intronic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022109245 7:27218209-27218231 TGGGAGGGAGGGAGGGAAGAAGG - Intergenic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022427417 7:30282705-30282727 GGGTGAGGAGAGAGGAAAGAAGG + Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022515925 7:30974950-30974972 ACCTGGGGAGAGAGGAAAGAAGG - Exonic
1023168031 7:37362610-37362632 TTTGAGGGAGGGAGGGAAGAAGG - Intronic
1023176119 7:37437272-37437294 TTGAGGGGAGAGAATGGAGATGG - Intronic
1023267148 7:38418649-38418671 TTGGAGGGAGAAAGGGAAAAAGG - Intronic
1023505874 7:40899228-40899250 TGGTGAGGAGGGAGGGAAGGAGG - Intergenic
1023569966 7:41561624-41561646 TGGTGGGAAGAGAGAGAGGAAGG + Intergenic
1023585310 7:41724023-41724045 AAGAGGGGAGAGAGGGAAAAAGG + Intergenic
1024019935 7:45359593-45359615 TTTTCAGGAGAGAAGGAAGAGGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1026112077 7:67466396-67466418 GGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1026206013 7:68258117-68258139 GAGTGGGGAGACAGGGAATAAGG + Intergenic
1026450216 7:70522446-70522468 AGGAGTGGAGAGAGGGAAGAAGG - Intronic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027659207 7:80968787-80968809 TTATGGGGAGAGTGGTAAGGTGG + Intergenic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1028252045 7:88548030-88548052 TGGCTGGCAGAGAGGGAAGATGG + Intergenic
1028362281 7:89983764-89983786 TGGTGGGGGGAGAGGGGAGGGGG - Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1028637145 7:93002050-93002072 ACTTGGGGAGAAAGGGAAGAAGG - Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028879577 7:95864973-95864995 TTGTGGGGAAAGGGGGAAGGTGG + Intronic
1028943416 7:96551136-96551158 ATGAAAGGAGAGAGGGAAGAGGG + Intronic
1029154389 7:98504813-98504835 TGGTGGGGAGAGAAGGCAGATGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029495596 7:100894377-100894399 ATGAGGGGAGAGAGGGAGGGAGG + Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1030130335 7:106194215-106194237 TGGGGAGGAGAGAGGGAAGGAGG + Intergenic
1030282993 7:107796489-107796511 GTGGGTGGAGAGATGGAAGAGGG - Intronic
1030289923 7:107861897-107861919 TGGTGAGGAGGGAAGGAAGAAGG + Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1030713906 7:112787377-112787399 TTTTGGGGGGAGGGGGAAGGGGG + Intronic
1031070541 7:117156588-117156610 ATGTGGAGAGATAGAGAAGAGGG + Intronic
1031325125 7:120386375-120386397 TTGAGGGGGAAGAGGCAAGAAGG - Intronic
1031414497 7:121479387-121479409 GGGTGGAGAGAGAGGGGAGAGGG + Intergenic
1031651652 7:124298848-124298870 ATGGGGGGTGAGAGGGAGGAGGG - Intergenic
1031914424 7:127549614-127549636 TTGTTAGGAGAGAGATAAGAAGG + Intergenic
1032290530 7:130586310-130586332 TTGGGGGGAGAGTGGGAAGCAGG + Intronic
1032412375 7:131706125-131706147 TTGCAGGAAGAGGGGGAAGACGG - Intergenic
1032805945 7:135354175-135354197 TTATAGGGAGAGAGGTGAGATGG - Intergenic
1033423922 7:141226219-141226241 TTGGGGGGAGGGTGTGAAGAAGG + Intronic
1033451007 7:141462469-141462491 ATGTGGGGAGAGAGGAGAGCTGG + Intronic
1033943218 7:146681456-146681478 TGGCGGGGGGAGAGGGTAGAGGG + Intronic
1033970958 7:147038982-147039004 TTGTTGGAAGAGTGTGAAGAAGG - Intronic
1033988861 7:147259962-147259984 TTGTGGGGAGGGAGGGATAGTGG - Intronic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1034488168 7:151379199-151379221 TTGTGGGGAGAGAAGAATGGGGG + Intronic
1034539706 7:151749195-151749217 TAGTGAGGAGAGAGAAAAGATGG - Intronic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037012317 8:13858968-13858990 TTGTTTGGAGAGAGGAAAGGAGG - Intergenic
1037209354 8:16366890-16366912 AAGAGGGGAGAGTGGGAAGAGGG + Intronic
1037234696 8:16704103-16704125 TTGTGGGGAAAGAGCTTAGAAGG - Intergenic
1037334683 8:17780564-17780586 TACTGGGGAGAGAGGGAAAGAGG - Intronic
1037384312 8:18320904-18320926 TTGTAAGGAGAGAGTGAATAAGG + Intergenic
1037402851 8:18510271-18510293 TTGTGGGGAGAGGGAGGAGGAGG - Intergenic
1037424537 8:18741147-18741169 TGGTGGGGAGAAAGGAAGGAAGG + Intronic
1037578187 8:20227820-20227842 TTCTGGAGAGAAAGGGGAGATGG - Intergenic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1038364769 8:26919876-26919898 TTCTGGCAAGAGAGGAAAGAAGG - Intergenic
1038492591 8:27981491-27981513 GTGAGGGGAGACAGGGAAGCTGG - Intronic
1038745683 8:30252857-30252879 TGGTGGGGACAGCTGGAAGACGG + Intergenic
1038911796 8:31973055-31973077 TGGTGTGGAGAATGGGAAGAGGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039550801 8:38441447-38441469 TGCTGGGGAGAGAGGAAGGAGGG - Intronic
1039721379 8:40168356-40168378 TTTAGGGGAGTGTGGGAAGAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040399074 8:47029972-47029994 GTGGGGGGAGAGAGGGAGGGAGG + Intergenic
1040506956 8:48057640-48057662 TTCTGGGGAGGGAGGGAAAGGGG + Intronic
1040930488 8:52729770-52729792 TTGTTGTGAGAGATGGAATAAGG - Intronic
1040960291 8:53024769-53024791 GACTGGGGAGAGAGGGAAGGAGG - Intergenic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041577131 8:59411213-59411235 TTATGGGGAGCAAGGGAGGATGG + Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042040349 8:64582131-64582153 GGGTGGGGAGGGAGGGAGGAGGG + Exonic
1042262366 8:66872363-66872385 TGGTGGGGTCATAGGGAAGAAGG - Intronic
1042402085 8:68361162-68361184 TTGAAAGGAGTGAGGGAAGAAGG + Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043285959 8:78531766-78531788 TTGTGGAAAGAAAGGGAAGGAGG + Intronic
1043285962 8:78531783-78531805 AGGAGGAGAGAGAGGGAAGAAGG + Intronic
1043517380 8:81007198-81007220 TTGTGGGAAGTGCGGGAAAAAGG + Intronic
1043963491 8:86445333-86445355 TGGGAGGGAGAGAGGGAGGAAGG - Intronic
1044244629 8:89928351-89928373 TTGTGGGGGGAGGGGGATAAAGG + Intergenic
1045139780 8:99267762-99267784 TTCTGGGGAGAAAGTGAAGCTGG + Intronic
1045164346 8:99586611-99586633 TTGTGGGGAGAGGGAAAAGATGG + Intronic
1045340748 8:101252386-101252408 TTTTGGGGCAAGTGGGAAGAGGG + Intergenic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1045906782 8:107355241-107355263 TGGTAGGGAGAGAGGGAAGCGGG - Intronic
1046344877 8:112910441-112910463 TTGTAGGGGGAAATGGAAGAAGG - Intronic
1046409877 8:113827770-113827792 TTCTTGGGAGAGATGGATGAAGG - Intergenic
1046463250 8:114570092-114570114 TTATGGAAAGAGAGGAAAGAAGG - Intergenic
1046478505 8:114782199-114782221 TTTGGGGGAAAGAGAGAAGATGG + Intergenic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046719167 8:117599551-117599573 TTTTTGTGAGGGAGGGAAGAAGG - Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1047415798 8:124663546-124663568 GTGTGGGGAGAAAGGGGAGGTGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047613753 8:126545769-126545791 TTGTGGGGAGAGGGGGAGGAGGG + Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047969241 8:130070808-130070830 TTGAGGGGAGAGAGGGAGAGAGG + Intronic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048053960 8:130846503-130846525 AGGGAGGGAGAGAGGGAAGAAGG - Intronic
1048291371 8:133184086-133184108 TTGCGGGGAGGGAGGCATGAGGG + Intergenic
1048318737 8:133382084-133382106 TGGGCAGGAGAGAGGGAAGATGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049055521 8:140233603-140233625 TGGTGGGGAGAGAGGGAGGGAGG - Intronic
1049291947 8:141808074-141808096 TTGTGGCTAGAGTGGAAAGAAGG + Intergenic
1049348990 8:142154076-142154098 CTGTGGGGAGAGCTGCAAGAGGG - Intergenic
1049354356 8:142180192-142180214 TTCAGGGGTGAGAGGGAGGAGGG + Intergenic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1050218017 9:3350458-3350480 TTGTTGGGAGGGATGGAAAATGG + Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050567259 9:6899227-6899249 ATGTGGGGAGAAGGGGAATATGG - Intronic
1050719960 9:8577106-8577128 TGGTGGGGAGAGTGGAAAAAAGG - Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051101742 9:13529915-13529937 TTCTGGGGTGAGTGGGGAGAGGG + Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051202441 9:14642661-14642683 ATGTGGGGACAGAGAGAAGGTGG + Intronic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1051842140 9:21410602-21410624 ATGTGGGGAGAGAGTGTCGAGGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052069666 9:24066835-24066857 AGGGTGGGAGAGAGGGAAGAAGG - Intergenic
1052671558 9:31563948-31563970 TTTTGGGAAGAGACAGAAGAGGG + Intergenic
1052859390 9:33427520-33427542 CTGTGGGGAGAGAGAAAGGAAGG + Intergenic
1053030318 9:34770713-34770735 TTAGGTGGAGAAAGGGAAGAGGG + Intergenic
1053163804 9:35830731-35830753 TTGTGGGCAGACCGGGGAGAAGG - Intronic
1053182106 9:35981576-35981598 TGGTAGGAAGAGAGGGAAGGAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053485190 9:38447903-38447925 AGGGAGGGAGAGAGGGAAGAAGG - Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1054953181 9:70876905-70876927 TTGTGGAGAGAGGTGGAAGGAGG - Intronic
1055365975 9:75545174-75545196 AGGTGGGGAGAGAGGGAGGGAGG - Intergenic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1055656885 9:78459563-78459585 TTGTGGGGAGGGTTGGGAGAAGG + Intergenic
1055845238 9:80554636-80554658 TTGTGGTCACAGAGAGAAGATGG + Intergenic
1055994181 9:82139801-82139823 TTTGGGGGAGAGAGTTAAGAGGG - Intergenic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1056726466 9:89123428-89123450 TTCTGATGAGAGATGGAAGAGGG + Intronic
1056955384 9:91076886-91076908 TTGTGGGGAGAGACCAAAGCAGG + Intergenic
1057250864 9:93500515-93500537 TTGTGGGGAGTGACGGGGGAAGG - Intronic
1057261967 9:93589836-93589858 TTGTGTGGAGAGAGGGAAAGGGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057503984 9:95617829-95617851 CCTTGGGGAGAGACGGAAGAGGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058223851 9:102336667-102336689 TTATGGAGACAGAGGGAATATGG - Intergenic
1058438858 9:104989336-104989358 GTGTTGGGAGTGGGGGAAGATGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059021757 9:110583255-110583277 ATATGGGGAAAGATGGAAGAGGG + Intergenic
1059221109 9:112619552-112619574 TTTTGGGGGGAAAGGGTAGAAGG + Intronic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1059496185 9:114711256-114711278 TTGTGGTGGGGGCGGGAAGAGGG - Intergenic
1059667863 9:116466119-116466141 TTGCGGGGAGGGTGGGAAGCGGG + Intronic
1059670481 9:116486416-116486438 ATGGAGGGAAAGAGGGAAGAAGG + Intronic
1059832438 9:118112593-118112615 GTTTGGGGGGAGAGTGAAGAAGG + Intergenic
1059930690 9:119257721-119257743 TTGAGCTGAGAGAGGAAAGAAGG + Intronic
1060090158 9:120735509-120735531 TTGTGGGGCAAGGGTGAAGATGG + Intergenic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060551097 9:124485836-124485858 TGGTGGGGAGCGAAGGCAGATGG - Intronic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061587471 9:131578320-131578342 GCGTGGGGAGAGTGGGGAGAGGG + Exonic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1062201695 9:135306193-135306215 GGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1062629653 9:137458189-137458211 TGGTGGGGGGAGGGGGAAGTTGG - Intronic
1203406188 Un_KI270538v1:15766-15788 TTGTGGGGGGGGAGGGGTGAGGG + Intergenic
1185511412 X:667703-667725 TTGTGAGGAAAGAGGAAATAGGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186020607 X:5251177-5251199 GGCAGGGGAGAGAGGGAAGAAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1186420311 X:9420330-9420352 TTGGTGGGAGAGGGGGATGAAGG - Intergenic
1186426239 X:9465692-9465714 TTGCGGGGAGAGACGGAGGTCGG + Intronic
1186490700 X:9970154-9970176 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1186749457 X:12606741-12606763 AGGAAGGGAGAGAGGGAAGAAGG - Intronic
1186932067 X:14404843-14404865 TTTTGGAGAGAGAGGGCAGTGGG + Intergenic
1186932962 X:14414788-14414810 TAGTAGGGACAGAGAGAAGAGGG + Intergenic
1186933254 X:14418272-14418294 TTGTGGGGAGGGGGGGGAGGGGG - Intergenic
1187929069 X:24277383-24277405 ATGCGGGGAGAGAGGGAGCATGG - Intergenic
1188212957 X:27445265-27445287 TTCAGAGGGGAGAGGGAAGATGG - Intergenic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188433135 X:30129561-30129583 TGGGGGGAAGAGGGGGAAGAGGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1189724443 X:43954435-43954457 AAATGGGGAGAGAGGGAGGAGGG - Intronic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1189904058 X:45739499-45739521 GTGTGGGGAGTAAGGGAAAATGG + Intergenic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190136965 X:47806641-47806663 TGATCTGGAGAGAGGGAAGAGGG - Intergenic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190947187 X:55107083-55107105 TTAAAGGGAGAGAGGGATGAAGG + Intronic
1192034282 X:67546170-67546192 TTGTAGAGAGACAGGGTAGACGG - Exonic
1192290591 X:69790316-69790338 ATGTCGGGAGAGGGGGCAGAGGG + Intronic
1192300853 X:69900875-69900897 TAGTAGGGAGAGAGAAAAGAGGG - Intronic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1194250040 X:91563093-91563115 CCGAGGGGAGAGAGGCAAGAAGG - Intergenic
1194649831 X:96501304-96501326 GAGTGGGGAGAGAGGGAATGAGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195611310 X:106870461-106870483 ATGTGGCGAGAGAGGGAGAAAGG - Intronic
1196047760 X:111274193-111274215 TTGTGGGGATAGTGGTAAGGAGG + Intergenic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196251326 X:113463515-113463537 TTATGGGGATAGAGGGTAGAAGG - Intergenic
1196754955 X:119149915-119149937 TTGTAGGGAGATAAGGGAGATGG - Intronic
1196834645 X:119802937-119802959 TTATGGGGAGAGAGTGAAGTAGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197106243 X:122720129-122720151 TTGTGGCAGGAGAGGGATGAGGG - Intergenic
1197209828 X:123819479-123819501 TTGTAGAGAAAGAGGGAAGGGGG + Intergenic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197708516 X:129650503-129650525 TCTTGGGGAAAGAGGGAAGGAGG - Intronic
1197753836 X:129981925-129981947 TGGGGGGGGGAGCGGGAAGAAGG + Intronic
1197816852 X:130506586-130506608 TTGAAGGGAGGGAGGAAAGAAGG - Intergenic
1197893576 X:131288582-131288604 TTGAGGGGAGTCAGGGAAGCTGG + Intronic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198546966 X:137702399-137702421 GTGTGGGGAGCTAGAGAAGAGGG - Intergenic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199137506 X:144270503-144270525 TTACGGGGAGAGTGGGAAGAGGG + Intergenic
1199316580 X:146385562-146385584 GAGTGGGGAGAGAGAGAAAAGGG + Intergenic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199503855 X:148539618-148539640 TTGGGTGGGGAAAGGGAAGAGGG - Intronic
1199507493 X:148580968-148580990 TATTTGTGAGAGAGGGAAGAAGG - Intronic
1199617659 X:149670699-149670721 TGGTGGGGAGAGAGGAAGGAGGG - Intergenic
1199624984 X:149732550-149732572 TGGTGGGGAGAGAGGAAGGAGGG + Intergenic
1199711460 X:150472661-150472683 TAATGGGGAGAGAGGGAGGAGGG + Intronic
1199825827 X:151498386-151498408 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199834881 X:151579678-151579700 TTATTGGGAGAAAGTGAAGATGG + Intronic
1199841932 X:151658043-151658065 GTAGGGGGAGAGGGGGAAGAGGG - Intronic
1199871716 X:151904384-151904406 TGGTGGGGAGGGAGGAAGGAGGG - Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1199896000 X:152128252-152128274 TGGTGGGGAGGGAGGAAGGAGGG + Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200015966 X:153164115-153164137 TGGTGGGAAGAGAGGAAGGAGGG - Intergenic
1200123428 X:153802092-153802114 TTGGGGTGGGAGAAGGAAGAGGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200978209 Y:9236335-9236357 ATGGAGGGAGAGAAGGAAGAGGG - Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1202107800 Y:21388330-21388352 TTGGAGGGAGGGAGGGAATAAGG + Intergenic