ID: 1028429420

View in Genome Browser
Species Human (GRCh38)
Location 7:90730166-90730188
Sequence ATGAGTTCATGTCCTCTGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37727
Summary {0: 3, 1: 162, 2: 5765, 3: 22160, 4: 9637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028429420_1028429423 7 Left 1028429420 7:90730166-90730188 CCGCGCAGAGGACATGAACTCAT 0: 3
1: 162
2: 5765
3: 22160
4: 9637
Right 1028429423 7:90730196-90730218 TATGGCTGCATAGTATTCCATGG 0: 24516
1: 14054
2: 8260
3: 5392
4: 3574

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028429420 Original CRISPR ATGAGTTCATGTCCTCTGCG CGG (reversed) Intronic
Too many off-targets to display for this crispr