ID: 1028432813

View in Genome Browser
Species Human (GRCh38)
Location 7:90767113-90767135
Sequence CCCCATGCACAGTGTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 3, 1: 3, 2: 8, 3: 40, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028432804_1028432813 9 Left 1028432804 7:90767081-90767103 CCATGCCATACTGACCCATGCTA 0: 1
1: 0
2: 0
3: 1
4: 111
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242
1028432805_1028432813 4 Left 1028432805 7:90767086-90767108 CCATACTGACCCATGCTAAACCA 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242
1028432806_1028432813 -5 Left 1028432806 7:90767095-90767117 CCCATGCTAAACCAAGCCCCCCA 0: 1
1: 0
2: 0
3: 17
4: 326
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242
1028432807_1028432813 -6 Left 1028432807 7:90767096-90767118 CCATGCTAAACCAAGCCCCCCAT 0: 1
1: 0
2: 2
3: 7
4: 126
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242
1028432802_1028432813 19 Left 1028432802 7:90767071-90767093 CCAAGCCATGCCATGCCATACTG 0: 1
1: 1
2: 2
3: 37
4: 185
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242
1028432803_1028432813 14 Left 1028432803 7:90767076-90767098 CCATGCCATGCCATACTGACCCA 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG 0: 3
1: 3
2: 8
3: 40
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028432813 Original CRISPR CCCCATGCACAGTGTCAGCA GGG Intronic
901470833 1:9455330-9455352 CCCCATGCACAGCGAGAGCTAGG + Intergenic
902542261 1:17163610-17163632 CCCCATGCACCCTGCCAACATGG - Intergenic
903385683 1:22924628-22924650 TCCCCTGCACTGTGTCATCAGGG - Intergenic
903539130 1:24086945-24086967 CCCCATGCTCAGGGGCAGCCTGG - Intronic
904451708 1:30617126-30617148 ACCCATGGAGAGTGTGAGCAAGG + Intergenic
904770526 1:32878679-32878701 CCCCATGCATAGTCTCAGGGAGG + Intergenic
907500351 1:54875221-54875243 CATCACACACAGTGTCAGCAGGG + Intronic
907748085 1:57234836-57234858 CCCCCAGCACATAGTCAGCAAGG - Intronic
909039412 1:70631071-70631093 CCACATGTACAGCATCAGCAGGG - Intergenic
910392130 1:86756353-86756375 CCCCCTTCTCAGTGTAAGCAGGG + Intergenic
910637505 1:89425410-89425432 GCACCTGCACAGTGTCAACAGGG - Intergenic
911306484 1:96238725-96238747 CCCCATTCACAGGGACAGCTTGG + Intergenic
912023610 1:105138710-105138732 CCTCATGTACAGTGTCAGCAGGG - Intergenic
912515955 1:110216685-110216707 ACCCATGGGCAGTGTCAGCCTGG + Intronic
913555622 1:119963729-119963751 CACCATGGTCAGTGTCAGGATGG - Exonic
914442447 1:147719289-147719311 CCCCATGCACAGCATCAGCAGGG - Intergenic
915056754 1:153140289-153140311 CCACCTGGACAGTGGCAGCATGG + Intergenic
916746355 1:167687713-167687735 CCCAATGCACAGTGCCAGGAAGG + Intronic
918413815 1:184287294-184287316 CCGTATGTACAATGTCAGCAGGG - Intergenic
919216936 1:194568777-194568799 CCTGATGCACAGTGGCATCATGG - Intergenic
919356840 1:196535766-196535788 CCATATGTACAGTGTCAGCATGG + Intronic
919937655 1:202265252-202265274 CCCCATGCTCTCTGTCACCATGG + Intronic
922283794 1:224150636-224150658 CCCCAAGGTCAGTGTCAGCTTGG - Intronic
923265878 1:232313697-232313719 GGCCAAGCACAGTTTCAGCAAGG + Intergenic
924418260 1:243882563-243882585 CCGTATGTACAGTGTCAGCAGGG - Intergenic
924669656 1:246110646-246110668 ACGCCTGCACAGTGTCACCAGGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063196412 10:3747632-3747654 CCGCATGCACAGTGTGCTCAGGG - Intergenic
1063687019 10:8246709-8246731 CCACAATCACGGTGTCAGCAGGG + Intergenic
1064627125 10:17272899-17272921 CCATATGCACAGTGTCAGCCGGG + Intergenic
1064740279 10:18426152-18426174 CCCCAAACAAAATGTCAGCAGGG - Intronic
1067748341 10:48953165-48953187 CCCCATGCACACTGAGATCAGGG + Intronic
1067778571 10:49180205-49180227 CCCACCCCACAGTGTCAGCAAGG + Intronic
1068438169 10:57017618-57017640 GCCCATGCATAGCATCAGCAGGG - Intergenic
1068657261 10:59588498-59588520 GACCATGCACAGAGTCAGCAGGG + Intergenic
1069098451 10:64288582-64288604 ACCCAAGCACACTGTCAGCATGG + Intergenic
1071259986 10:83910912-83910934 CCTCAGCCACGGTGTCAGCAGGG - Intergenic
1073539423 10:104306321-104306343 TCCCAGGTACAGTGGCAGCAAGG + Intergenic
1074111361 10:110424946-110424968 CCCCATGCACATTTAAAGCATGG + Intergenic
1076420485 10:130327859-130327881 CCACATTCAAGGTGTCAGCAGGG + Intergenic
1077080808 11:723970-723992 CCTCACCCACAGTGTCAGCCTGG + Intronic
1078259398 11:9690596-9690618 CACCATGCCCAGTCTCAACAAGG - Intronic
1078480318 11:11669638-11669660 CTCTATGCACAGGCTCAGCATGG + Intergenic
1078815115 11:14813269-14813291 CCCAAAGCAAGGTGTCAGCAGGG + Intronic
1080089246 11:28325130-28325152 GCACCTGCACAGTGTCAGCAGGG + Intronic
1083920686 11:65780316-65780338 CTCCATGCTCAGGGCCAGCAGGG + Exonic
1084895676 11:72266109-72266131 CTCCAAGCACAGTGGCAGCCAGG - Intergenic
1085181477 11:74540564-74540586 CCATATGTACAGTGTCAGCTGGG - Intronic
1085851595 11:80126514-80126536 CCCCTAACACAGTGTCTGCATGG + Intergenic
1086972673 11:93100388-93100410 CCCCAAGCACAGGGCCTGCATGG - Intergenic
1087183956 11:95166712-95166734 ACACATACACAGTCTCAGCAAGG - Exonic
1092603147 12:10089158-10089180 CACCAAGCACAAAGTCAGCAGGG + Exonic
1092950741 12:13500683-13500705 CCAAAGGCACAGAGTCAGCAGGG - Intergenic
1099411534 12:82334862-82334884 CCCCATGCAGTGTGGCATCATGG + Intronic
1099573539 12:84355823-84355845 CCATATGTACAGTGTTAGCAGGG - Intergenic
1100799070 12:98212456-98212478 CCCTGTGCACAGCGTCAGCAGGG + Intergenic
1102027978 12:109724258-109724280 GGCCATGCATAGTGTCAGCCAGG - Intronic
1103289632 12:119834450-119834472 CACCATGCACAGTGTTTGCAAGG + Intronic
1104158086 12:126152605-126152627 CCCCAAGCACATTGTAAGGATGG - Intergenic
1104955457 12:132463039-132463061 CCCCATTCTCAGCTTCAGCAGGG + Intergenic
1104982866 12:132581950-132581972 CCCCCTTCTCAGTGTCAGCCTGG + Intronic
1105258577 13:18761627-18761649 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
1106724656 13:32471472-32471494 CCCTGTGCACGGTGACAGCAGGG - Intronic
1109388581 13:61665440-61665462 CCCTGTGCACAGTGTCAGCAGGG + Intergenic
1109448853 13:62482494-62482516 CCCTATGCACAGTGTCAGCAGGG + Intergenic
1112589419 13:100749896-100749918 CCCAATTCACAGTTTTAGCATGG - Intergenic
1113919236 13:113897541-113897563 GTCCATGAACAGTGTCTGCAGGG - Intergenic
1113947040 13:114050177-114050199 CCCCTTGCTCAGTGTCTGCCTGG - Intronic
1117548687 14:56812611-56812633 CCCCATGCCCACTGTCCCCAAGG - Intergenic
1118463610 14:66010755-66010777 GCACATGTACAGTGTCAGCAGGG + Intergenic
1118848232 14:69564549-69564571 CCCCATGCACAGTGAGAGCCAGG + Intergenic
1119097937 14:71851600-71851622 CCCCCTGCATAGAGTTAGCATGG + Intergenic
1120445269 14:84587453-84587475 GCACCTGTACAGTGTCAGCAGGG + Intergenic
1121228114 14:92336651-92336673 CCCCATGCTCACTGACAGCAGGG - Intronic
1121659702 14:95625573-95625595 CCACATCCACTGTGTCACCAAGG - Intergenic
1202834869 14_GL000009v2_random:70517-70539 CCCCAGGGCCAGTGACAGCAAGG - Intergenic
1123405801 15:20018810-20018832 CCACATGCCCAGTGCCAGCTAGG + Intergenic
1123515131 15:21025458-21025480 CCACATGCCCAGTGCCAGCTAGG + Intergenic
1123760295 15:23426653-23426675 CCCCATGTGCAGTGAGAGCAAGG - Intergenic
1123895896 15:24829508-24829530 CCCCATGCCCAGTCCCTGCATGG - Intronic
1126581682 15:50247986-50248008 CCCAGTGCTCAGTGACAGCAAGG + Intronic
1126729850 15:51671616-51671638 CCCTATGCCCAGTCACAGCAGGG - Intergenic
1128750069 15:70142502-70142524 CTCCATGCCAAGGGTCAGCAGGG - Intergenic
1129257976 15:74345006-74345028 CCCCATGCCCACTGCCAGCCAGG + Intronic
1129464937 15:75718935-75718957 CCGCCTGCACAGTGTCACCTGGG - Intergenic
1130935261 15:88464750-88464772 CCCCAGGCAGAGTGGCAGCCTGG - Exonic
1131266360 15:90917761-90917783 CCACATCCACAGTGCCAGCCTGG - Intronic
1132599958 16:768967-768989 CCCTCAGCACAGTGGCAGCAGGG - Intergenic
1132771356 16:1565241-1565263 GCCCAAGAACAGTGGCAGCAGGG + Intronic
1134892231 16:17851331-17851353 CCCCAAGAAGAGTGTCATCAGGG + Intergenic
1136571533 16:31100542-31100564 CCCTGTGCACAGTGTCAGCAGGG - Intergenic
1137009347 16:35308140-35308162 CACCATGCCCAGTGTATGCAGGG + Intergenic
1137781451 16:51100986-51101008 TTCCTAGCACAGTGTCAGCATGG + Intergenic
1141641762 16:85345739-85345761 CCCCAGCCAGAATGTCAGCAGGG + Intergenic
1141783452 16:86181405-86181427 CCCCATGGACAGATTCAGCAAGG - Intergenic
1142686252 17:1578409-1578431 CCCCAGGGGCAGTGTCAGCCTGG + Intronic
1145241414 17:21242792-21242814 CCCCATGCCCAGTGCAGGCAGGG - Exonic
1146141759 17:30374198-30374220 TGTCATGCACAGTGTCAACAGGG + Intergenic
1146306480 17:31733492-31733514 CTCCATGCACAGTGGCTCCAGGG + Intergenic
1147198017 17:38780562-38780584 CCCCATCAACAGTGACAGCCAGG - Exonic
1147659259 17:42108490-42108512 CTCCGTGAACAGCGTCAGCAGGG - Intronic
1147838952 17:43356701-43356723 CCCCGTGCACAGTGTCAGCAGGG - Intergenic
1147852618 17:43453555-43453577 GCACCTGTACAGTGTCAGCAGGG - Intergenic
1148335414 17:46837683-46837705 CCCCAGGCACATTCCCAGCAGGG - Intronic
1151502711 17:74501845-74501867 CCACATGTACAGCGTCAGCAGGG + Intergenic
1152125559 17:78444642-78444664 CACCATGCACAGCTTCTGCAGGG + Exonic
1152330930 17:79672654-79672676 CACCATGCTCAGAGGCAGCAAGG - Intergenic
1152533115 17:80932030-80932052 CCACATGCTGAGTGTCACCATGG + Intronic
1154423901 18:14257638-14257660 CCCCATGGTCTGTGACAGCAAGG - Intergenic
1154424782 18:14263880-14263902 CCCCAGGGCCAGTGACAGCAAGG - Intergenic
1154432472 18:14319103-14319125 CCCCAGGGCCAGTGACAGCAAGG - Intergenic
1156087499 18:33424549-33424571 CCCTATGCACAGCGTCAGAAGGG - Intronic
1158111494 18:53944774-53944796 CCCCATGTACAGCATCAGCAGGG + Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1158609345 18:58924418-58924440 AACCATGAACAGTGGCAGCAAGG - Intronic
1158680412 18:59561587-59561609 GCACCTGTACAGTGTCAGCAGGG - Intronic
1159392408 18:67809845-67809867 CTCCATCCACAGGGTAAGCAGGG + Intergenic
1159524316 18:69568193-69568215 CCATATGCACAGCGTCAGCAGGG + Intronic
1159609943 18:70513830-70513852 GCACATGGACAGTGTCAGCAGGG + Intergenic
1160975859 19:1792097-1792119 GGCCAGGCACAGTGTCCGCAGGG + Exonic
1161906109 19:7157731-7157753 CACCAAGCAGAGTGGCAGCAGGG - Intronic
1161992016 19:7689531-7689553 CCCCAGGCACAGACTCAGGATGG - Intronic
1162528689 19:11222846-11222868 TTCCATGCGCAGGGTCAGCAGGG + Exonic
1163743642 19:19032474-19032496 TCCCATTCACAGACTCAGCAGGG + Intronic
1164455909 19:28406429-28406451 CCCCATGTACCCTGTTAGCAAGG - Intergenic
1164855042 19:31514084-31514106 CCCCACGCACCGTGCCGGCATGG + Intergenic
1168490129 19:56802207-56802229 CCTCATGCCCAGTGTCAGCCTGG - Intronic
1202637834 1_KI270706v1_random:57175-57197 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
925200535 2:1964865-1964887 CCCCAAGCTCCTTGTCAGCAGGG - Intronic
925216307 2:2098616-2098638 CCCCCTGCCCTGTGTCTGCAGGG - Intronic
925254867 2:2474852-2474874 CCCCATGCTCAGGTTCAGCCAGG + Intergenic
925254887 2:2474912-2474934 CCCCATGCTCAGGTTCAGCCAGG + Intergenic
925456436 2:4020482-4020504 GCACCTGCACAGTGTCAACAGGG - Intergenic
925845706 2:8031510-8031532 CCAAAAGCAAAGTGTCAGCAGGG + Intergenic
925851471 2:8086431-8086453 GACATTGCACAGTGTCAGCAGGG - Intergenic
926775570 2:16419185-16419207 CCCCATGCACTGTATTACCAGGG + Intergenic
928132672 2:28664405-28664427 ACGCCTGTACAGTGTCAGCAAGG - Intergenic
928177223 2:29042807-29042829 AAGCCTGCACAGTGTCAGCAGGG + Intronic
928296762 2:30090466-30090488 CCTTTTGCACAGTGTCAGGAAGG + Intergenic
928374373 2:30763090-30763112 CCCCAGTCACAGTGTAGGCATGG + Exonic
934493244 2:94776642-94776664 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
934878446 2:97950214-97950236 CCCCATGAAAAGTGTTCGCAAGG + Intronic
935602977 2:104941516-104941538 CTCCCTGCACTGTGTCTGCAGGG + Intergenic
935638296 2:105267288-105267310 CACCATGCTCTGTGTCAGCCAGG - Exonic
935699980 2:105802940-105802962 CACCAAGCACAGTGCTAGCAGGG + Intronic
936047396 2:109198054-109198076 CCCCATGCAGTGTGTCAGTTGGG + Intronic
936526078 2:113242353-113242375 CCTCCTGCACAGTGTCAGCAGGG - Intronic
938011280 2:127831078-127831100 CCATAGGTACAGTGTCAGCAGGG - Intergenic
938072328 2:128315317-128315339 CCCATTGCACAGTATCAGCCTGG - Intronic
939057288 2:137380907-137380929 CCATATGTACAGTGTTAGCAGGG - Intronic
939057715 2:137383680-137383702 CCATATGTACAGTGTTAGCAGGG - Intronic
939598741 2:144162187-144162209 CACCCAGGACAGTGTCAGCATGG - Intronic
942223877 2:173798051-173798073 TCCTATTCACAGTGTCAGCTGGG + Intergenic
942352039 2:175063085-175063107 GCGCCTGAACAGTGTCAGCAGGG + Intergenic
942828105 2:180205121-180205143 CAGCATGCACAGTGTATGCAAGG + Intergenic
945219652 2:207470750-207470772 CTCCATGCACTGTATCAGAAGGG + Intergenic
946381676 2:219353086-219353108 CCCCATGACCAGGGTGAGCAGGG - Intergenic
946465641 2:219909602-219909624 CCCAATTCAAAGTGTCAGCAGGG + Intergenic
948660863 2:239505764-239505786 CCCCATGCCCAGGGTGACCATGG + Intergenic
1168789840 20:568553-568575 CCCCAGGCTCAGTGTCAGGTTGG + Intergenic
1168894161 20:1312468-1312490 CACCATGCACAAGGACAGCATGG - Exonic
1170431939 20:16283906-16283928 CCCCTTGCTGAGAGTCAGCAAGG - Intronic
1171884404 20:30641267-30641289 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
1171884861 20:30644492-30644514 CCCCAGGGACTGTGACAGCAAGG + Intergenic
1172873808 20:38152203-38152225 CCCCAGGCACAGTGCCTGCCGGG + Intronic
1173111209 20:40192310-40192332 CCACATTCCCAGTGTCAGCCTGG - Intergenic
1173963581 20:47093718-47093740 CCCTGTGCACAGCGTCAGCAGGG + Intronic
1175670856 20:60901663-60901685 TCCCATGCACAGTCTATGCAAGG + Intergenic
1176844568 21:13866646-13866668 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
1176845004 21:13869893-13869915 CCCCAGGGACTGTGACAGCAAGG + Intergenic
1176847301 21:13886209-13886231 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
1181003546 22:19999048-19999070 TCCCTGGCACAGTGACAGCATGG + Intronic
1181627295 22:24130607-24130629 CCCCTTGCAGAGGTTCAGCAAGG + Intronic
1182445108 22:30385469-30385491 GCCCAGCCACAGTGGCAGCAGGG + Intronic
1182503350 22:30764505-30764527 CCCCAGGCACACAGGCAGCAGGG - Intronic
1184746567 22:46459566-46459588 CACCCTCCACAGTGCCAGCAGGG + Intronic
950039635 3:9911576-9911598 CCCCGTGTACACTGTCAGCCAGG + Exonic
950067870 3:10127703-10127725 GCTGAAGCACAGTGTCAGCATGG - Intergenic
951527714 3:23669823-23669845 CCCCATGCCCAGTATTACCATGG + Intergenic
952410676 3:33047244-33047266 CCCCTTGCACAGTGACTGCAGGG - Intronic
952435815 3:33271436-33271458 CCCTGTGCACAGTGTCAGCAAGG + Intergenic
952952608 3:38537211-38537233 GCACAGGCACAATGTCAGCATGG - Intronic
953003305 3:38954412-38954434 CCCTATGCTCAGTTACAGCAAGG + Intergenic
953108257 3:39907093-39907115 CCCCATGGACTGTGTCTGCTTGG + Intronic
953320130 3:41963971-41963993 ACCTGGGCACAGTGTCAGCAGGG - Intergenic
953844626 3:46417679-46417701 CCATATGTCCAGTGTCAGCAGGG + Intergenic
959455315 3:106552716-106552738 CCGCATGTACAGTGTCAGGAGGG + Intergenic
959886608 3:111509522-111509544 CCCCGTGCACAGCATCAGCAGGG - Intronic
962969622 3:140386787-140386809 GCCTGTGCACAGTGTCAGCAGGG + Intronic
963141693 3:141951006-141951028 CACCATGCTCAGTGTTAGCATGG + Intergenic
963981537 3:151543635-151543657 CCCTGTGCACAGTGTCAGCAGGG + Intergenic
964365735 3:155949335-155949357 CACCTTGCACAGTGCCAACACGG - Intergenic
964850930 3:161095523-161095545 CCCCATGGGCAGCATCAGCAGGG - Intronic
967072177 3:185971770-185971792 CCCCATGACCAGTGTCCGCGTGG + Intergenic
968830352 4:2930423-2930445 CCCTCTGCACAGTGGCAGCCTGG - Intergenic
968854935 4:3112854-3112876 CCCCATACACAGTGGCAAAAGGG - Intronic
969834755 4:9831569-9831591 GTGCATGTACAGTGTCAGCAGGG - Intronic
969846396 4:9923416-9923438 GCCCCCGTACAGTGTCAGCAGGG - Intronic
970701426 4:18745019-18745041 CACCATTCAAAATGTCAGCAAGG + Intergenic
972679837 4:41294782-41294804 CCATATGTACAGTGTCAGCAGGG - Intergenic
973368060 4:49223540-49223562 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
973392990 4:49571886-49571908 CCCCAGGGCCAGTGACAGCAAGG - Intergenic
975231868 4:71944968-71944990 ACACCTGTACAGTGTCAGCAGGG + Intergenic
976286832 4:83378718-83378740 TCCCATGTACAGTGTCTGCAGGG - Intergenic
979137255 4:117125275-117125297 CAGCATGTACAGTATCAGCAGGG - Intergenic
979863052 4:125718449-125718471 CCAAATGCAAGGTGTCAGCAGGG + Intergenic
982392244 4:154877378-154877400 ACACCTGTACAGTGTCAGCAAGG - Intergenic
983403458 4:167295164-167295186 CCGCATGCACACTGGAAGCATGG - Intergenic
984285908 4:177728559-177728581 GCCCCTGCACAGCATCAGCAGGG - Intergenic
1202765156 4_GL000008v2_random:143032-143054 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
985585474 5:730920-730942 CCCAGAGCACAGTGTCTGCAGGG - Intronic
986093154 5:4531230-4531252 GCCCATCCTCTGTGTCAGCAAGG - Intergenic
992266153 5:75020236-75020258 CCCCGTGCACAGCATCTGCAGGG - Intergenic
992434559 5:76742822-76742844 CCCCAGGCACAGTGGAATCATGG - Intergenic
992672987 5:79078117-79078139 AACCATGCACATTGTCAGCAGGG - Intronic
992859185 5:80894229-80894251 CCCCCTGCACACTGTAAGAATGG + Intergenic
993698947 5:91095444-91095466 TCCCATGCACAGTATCCTCATGG + Intronic
993847045 5:92957098-92957120 CCCCAGGCACAGAGGAAGCAGGG - Intergenic
994719807 5:103367351-103367373 CCCCATGCACAGTGTCAGCAGGG + Intergenic
994787741 5:104186372-104186394 CCATATGTACAGTGTCAGCGGGG - Intergenic
996241765 5:121212953-121212975 CCCCATCCACAGTGTCACTGGGG - Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
997978962 5:138457393-138457415 CCCCGGGTACAGTGGCAGCAGGG - Intergenic
998037930 5:138932403-138932425 CCCCAAGCAGAGTGTAGGCAAGG + Intronic
1000202844 5:159028652-159028674 CACCAAGCACAGTGCTAGCACGG + Intronic
1001473655 5:172033919-172033941 GCCCCTGCACAGTTTCTGCAAGG + Intergenic
1003566914 6:7229910-7229932 CTCCATGCTCAGCGGCAGCAGGG - Exonic
1003760452 6:9173471-9173493 CCACACGTGCAGTGTCAGCAGGG - Intergenic
1005562956 6:27060109-27060131 GCACCTGCACAGTGTCAACAGGG + Intergenic
1005661496 6:28003238-28003260 GCACCTGCACAGTGTCAACAGGG - Intergenic
1005696097 6:28354204-28354226 TCCTATGTACAGTGTCAGCAGGG + Intronic
1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG + Intergenic
1006669155 6:35718940-35718962 CCCACTGCACAGTTTCAGCAAGG - Intronic
1007275628 6:40671445-40671467 CCTCTTGCACAGCGTCAGCAGGG + Intergenic
1007822578 6:44571569-44571591 CACCATTCACTATGTCAGCACGG + Intergenic
1009883832 6:69601500-69601522 CCCCGTGCACAGTGACAATAGGG + Intergenic
1009909311 6:69905534-69905556 GCACTTGTACAGTGTCAGCAGGG + Intronic
1011647402 6:89472872-89472894 CCCCATGGTCACTGTCCGCATGG + Intronic
1014953403 6:127586477-127586499 CCGCATGCTCACTGGCAGCATGG - Intronic
1016962124 6:149683978-149684000 GCCGATTCACAGTGCCAGCAGGG + Exonic
1017082379 6:150682120-150682142 CACCATGCACAGAGGCTGCATGG - Intronic
1018536595 6:164827054-164827076 CCCTGTGCACAGCATCAGCAGGG - Intergenic
1018721076 6:166573028-166573050 CCCCAGGCACACTGTCCTCATGG - Intronic
1018854434 6:167665508-167665530 CCACACGCTCAGTGTCAGCTGGG - Intergenic
1018881200 6:167882971-167882993 CCCCATCCAGACTGTCAGCCAGG + Intronic
1018898861 6:168040993-168041015 ACCCATGCTCAGGTTCAGCAGGG + Intronic
1020633972 7:10673885-10673907 TCCCATACAAAGTGTCAGAATGG + Intergenic
1024008317 7:45243707-45243729 ACACATGCACAGTGACAGCGGGG - Intergenic
1024968754 7:55049790-55049812 CCCCATGCAATCTGTAAGCAAGG - Intronic
1026455052 7:70564286-70564308 CTCCATGCTCAGTGTCTGAAGGG + Intronic
1027754999 7:82202180-82202202 CCGTATGTACAGCGTCAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028432813 7:90767113-90767135 CCCCATGCACAGTGTCAGCAGGG + Intronic
1028844975 7:95470087-95470109 CTCTATGCACAGTATCAGGATGG - Intergenic
1030689429 7:112517375-112517397 CCCCATGCTCAATGTCAGCAAGG - Intergenic
1033222784 7:139539839-139539861 TTCCATGCACACTGACAGCAAGG + Intronic
1033421943 7:141211419-141211441 CCCCTAGCCCACTGTCAGCAGGG - Intronic
1035261025 7:157661728-157661750 CCCCAGGCTCAGGGGCAGCATGG - Intronic
1035496031 7:159326971-159326993 CTCTATACACAGTGTCAGCAGGG + Intergenic
1037308714 8:17532345-17532367 CCCCAATCCCAGTGTGAGCATGG + Intronic
1037376344 8:18233987-18234009 CCACATGCACATTAACAGCAAGG + Intergenic
1037623770 8:20590067-20590089 GCTCATGTACAGTGTCAGCAGGG + Intergenic
1037698905 8:21254057-21254079 AGCCATGCACAGTGTCTGTATGG - Intergenic
1039155779 8:34554904-34554926 CCACATTCAGGGTGTCAGCATGG - Intergenic
1039670771 8:39595358-39595380 CAACAGGCACAGTGTCAACAGGG - Intronic
1041991721 8:64000949-64000971 CCCTGTGCACGGTGTCAGCAGGG - Intergenic
1042789423 8:72587319-72587341 CTCCTTGCACAGTGACAGCATGG + Intronic
1044939456 8:97325851-97325873 GCACCTGTACAGTGTCAGCAGGG - Intergenic
1045297149 8:100882054-100882076 CCCCATGCACAGTGTCAGCAGGG + Intergenic
1046184113 8:110690574-110690596 CCCCCAGTACAGTGTTAGCAGGG + Intergenic
1046198820 8:110894765-110894787 CCCCGTGCACAGTGTCAGCAGGG + Intergenic
1046550186 8:115706154-115706176 CCCCCTGCTCATCGTCAGCAGGG + Intronic
1047873176 8:129107198-129107220 GCACCTGTACAGTGTCAGCAGGG - Intergenic
1048866554 8:138765671-138765693 ACACCTGCACAGTGTCAACAGGG - Intronic
1049348979 8:142154029-142154051 CCCCATGGACATGGACAGCACGG - Intergenic
1049388507 8:142356247-142356269 CCCCACGCAGAGAGGCAGCAGGG + Intronic
1049403317 8:142440574-142440596 TCCCATCCACTGTGCCAGCAGGG - Intergenic
1049569932 8:143364668-143364690 CCCCAGTCACAGGGTCAGCTCGG - Intergenic
1052443448 9:28528066-28528088 CTCAATGCAATGTGTCAGCAAGG + Intronic
1057214685 9:93221151-93221173 CCCCATGCCCAGCATGAGCACGG - Intronic
1058935601 9:109766992-109767014 CCCCAGGCACAGTGTCTGGCAGG - Intronic
1058981046 9:110170920-110170942 CCCCAGGCACAGTGGCAGTTAGG + Exonic
1061937054 9:133863736-133863758 CCCCATCCCCAGTGCCAGCTAGG - Intronic
1062010253 9:134263291-134263313 CCCCATGCCCAATTCCAGCAAGG - Intergenic
1062399781 9:136367305-136367327 CCCCAGGCACAGGGTGGGCAGGG + Intronic
1203545904 Un_KI270743v1:127921-127943 CCCCAGGGCCAGTGACAGCAAGG + Intergenic
1189276723 X:39791766-39791788 CACTATGCCCACTGTCAGCAGGG + Intergenic
1192261861 X:69510436-69510458 CCTCATACCCAGTGTTAGCAAGG - Intronic
1196138959 X:112239593-112239615 CCCTATCCTCAGTGTCAGCAGGG + Intergenic
1196628126 X:117901851-117901873 CTCCATACACAGTTCCAGCATGG + Exonic
1197626447 X:128807647-128807669 CCATGTGTACAGTGTCAGCAGGG - Intergenic
1198717859 X:139580690-139580712 ACTCATGCACAGTGTCATGAAGG - Intergenic
1199603343 X:149556679-149556701 GCCCCTGCACAGAGTCATCATGG + Intergenic
1199647044 X:149922796-149922818 GCCCCTGCACAGAGTCATCATGG - Intergenic
1199984029 X:152937600-152937622 CCCCATACACAGCGTCAACAGGG + Intronic
1200860256 Y:7983755-7983777 TCCAATGCAAAGTGTCAGTAAGG + Intergenic