ID: 1028434709

View in Genome Browser
Species Human (GRCh38)
Location 7:90789048-90789070
Sequence AAGTGCCATTGCAAGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028434709_1028434714 15 Left 1028434709 7:90789048-90789070 CCTTTGACCTTGCAATGGCACTT 0: 1
1: 0
2: 0
3: 34
4: 318
Right 1028434714 7:90789086-90789108 ACGGACATATTTTTACAGGATGG No data
1028434709_1028434712 -4 Left 1028434709 7:90789048-90789070 CCTTTGACCTTGCAATGGCACTT 0: 1
1: 0
2: 0
3: 34
4: 318
Right 1028434712 7:90789067-90789089 ACTTTTAGGAATTTAACTTACGG No data
1028434709_1028434713 11 Left 1028434709 7:90789048-90789070 CCTTTGACCTTGCAATGGCACTT 0: 1
1: 0
2: 0
3: 34
4: 318
Right 1028434713 7:90789082-90789104 ACTTACGGACATATTTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028434709 Original CRISPR AAGTGCCATTGCAAGGTCAA AGG (reversed) Intronic
902254541 1:15179190-15179212 AAGTGCAATTGCTGGGTCACAGG - Intronic
903013454 1:20346532-20346554 AAGTAGGATTGCAATGTCAAGGG + Intronic
904364984 1:30004766-30004788 GAGTCCCATTCCAAGCTCAAGGG + Intergenic
910054402 1:83013860-83013882 AAGTGGAATTGCCAGGTCATAGG + Intergenic
910146354 1:84084912-84084934 AAATGCCCTTGGATGGTCAAGGG + Intronic
910449688 1:87332286-87332308 AAGAGCAATGGCAAGGCCAAAGG + Intronic
910677471 1:89829116-89829138 GAGTGCCATTGCAAGCACCATGG - Intronic
913123935 1:115768028-115768050 AAGGGCCCTTGAAAAGTCAAGGG + Intronic
914512854 1:148349827-148349849 AACTGCCATTGCAAGATTATAGG - Intergenic
915271684 1:154758235-154758257 AAGTACAAGTGCAAGGTTAATGG + Intronic
917557434 1:176104761-176104783 AAGTGGGATTGCTGGGTCAAAGG - Intronic
917878520 1:179309397-179309419 AAGTGAAATTGCTAGGTCAAAGG + Intronic
919045908 1:192451549-192451571 AAGTGCCATCACTAAGTCAAGGG + Intergenic
923024139 1:230190943-230190965 AAGTGAAATTGCAGGGTCAATGG + Intronic
1064441319 10:15356426-15356448 GAGTGCCATTGCTAGATCATAGG - Intronic
1064901302 10:20298418-20298440 AAGCTCCATTGCAGGGTGAATGG - Intergenic
1066459156 10:35597995-35598017 CAGTGCCATTGCAGGGTCGGGGG + Intergenic
1066472751 10:35715280-35715302 GAGTGCAATTGCTAGGTCACAGG - Intergenic
1066759492 10:38739006-38739028 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1066962126 10:42233755-42233777 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1067361423 10:45583337-45583359 AAGTGGAATTGCCTGGTCAAAGG - Intronic
1068861035 10:61848470-61848492 AATTGGGATTACAAGGTCAAAGG - Intergenic
1069694201 10:70374770-70374792 AAGTGCATTTGCAAGGGGAAGGG + Intronic
1070054007 10:72916696-72916718 TAATGGCATTGCTAGGTCAAAGG + Intronic
1070375183 10:75823594-75823616 TAGTGGGATTGCAAGATCAAAGG - Intronic
1071257350 10:83883006-83883028 AAGTGACATTGCCAGGTCATAGG + Intergenic
1072062946 10:91834943-91834965 AAGTGGAATTTCCAGGTCAAAGG + Intronic
1072541913 10:96405029-96405051 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1073010522 10:100355765-100355787 CAGTGCCCTTGGAATGTCAATGG + Intronic
1073787584 10:106907177-106907199 CAGTGACTTTGCTAGGTCAATGG + Intronic
1073991377 10:109265988-109266010 AGGAGCTATTGCAAGGACAAGGG + Intergenic
1075024856 10:118977081-118977103 AAGCACCATTGCAAGGCCAAAGG - Intergenic
1075285329 10:121180423-121180445 AAGTGGCATTGCTGGGTCATAGG + Intergenic
1076717449 10:132373549-132373571 TACTCCCATTGCAAGGTCAGGGG + Intronic
1079674522 11:23208936-23208958 AAGTGCCATTCCATGGCAAAGGG + Intergenic
1080915502 11:36654257-36654279 GAGTGCCAGAGGAAGGTCAATGG - Intronic
1085090804 11:73711642-73711664 AAGTGGGATTTCCAGGTCAAAGG + Intronic
1086091127 11:83006197-83006219 AAGTGCAATTGCTGGGTCAGAGG - Intronic
1087540031 11:99504801-99504823 TAATGCAATTTCAAGGTCAAGGG - Intronic
1088837353 11:113589118-113589140 AATGGCCATTGCCAGGTGAATGG - Intergenic
1090750396 11:129741786-129741808 AGGTGTCATTGCTGGGTCAAGGG + Intergenic
1091093548 11:132794774-132794796 AAATGCCATTGCTAGGGGAAAGG + Intronic
1093412908 12:18887846-18887868 AAGTGCCAGTTCAAGAGCAAAGG - Intergenic
1094335342 12:29344276-29344298 AAGTGCAATTGCTGAGTCAAAGG + Intronic
1096356812 12:50948520-50948542 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1100100487 12:91097900-91097922 AAGTGCCATTGCTGGATCATAGG - Intergenic
1101824081 12:108207205-108207227 ATGAGCCACTACAAGGTCAAGGG - Intronic
1102001157 12:109558798-109558820 AAGTGGCATTGCGGGGGCAAAGG - Intronic
1102833184 12:116026755-116026777 AAGTGCTGTTGCTAGGTCACAGG - Intronic
1103289666 12:119834726-119834748 AAGTGGAATTACTAGGTCAAAGG - Intronic
1104495688 12:129235883-129235905 AAATGCCATTGGAATTTCAAGGG + Intronic
1104604053 12:130175046-130175068 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1108474768 13:50803128-50803150 AATTGGAATTGCTAGGTCAAAGG + Intronic
1108553000 13:51565122-51565144 AAGTCCCATAGCAGAGTCAAAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110777510 13:79425784-79425806 AAGTGGGATTGCTAGGTAAAAGG + Intergenic
1111406581 13:87814387-87814409 AAGTGCCATCCAAAGGGCAAAGG + Intergenic
1113321743 13:109239481-109239503 AAATGAGATTGCAGGGTCAAGGG - Intergenic
1113491706 13:110697413-110697435 AAGCGGAATTGCTAGGTCAAAGG - Intronic
1116462985 14:45199199-45199221 ATGTTAGATTGCAAGGTCAAAGG - Intronic
1116807889 14:49511277-49511299 AAGTCCCAGTCCAAGTTCAAAGG + Intergenic
1117342939 14:54807324-54807346 AGGTGAAATTGCTAGGTCAAAGG + Intergenic
1118828092 14:69402639-69402661 AAGTACAGTTGCCAGGTCAAAGG - Intronic
1118903844 14:70008887-70008909 AGGTGCCATGGCAACTTCAAGGG - Intronic
1119345472 14:73920078-73920100 AAGTGGGATTCCTAGGTCAAAGG + Intronic
1120168623 14:81226537-81226559 ATTTGGCATTGCTAGGTCAATGG - Intergenic
1121285915 14:92735730-92735752 TAGCTCCACTGCAAGGTCAATGG + Intronic
1122608194 14:102962277-102962299 AAGTGGGATTGCCAGGGCAAAGG - Intronic
1202930224 14_KI270725v1_random:28593-28615 CAGTGCCATGGCAAGGGCAAGGG - Intergenic
1123422152 15:20142907-20142929 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123442921 15:20303710-20303732 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1123531380 15:21149447-21149469 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1123853525 15:24383890-24383912 AAGTGCCATGGCCAGAGCAAGGG - Intergenic
1124260511 15:28185442-28185464 AAGTGAAATTGCTAAGTCAAAGG - Intronic
1124391024 15:29257524-29257546 AAGTGGCATTGCTGGATCAACGG + Intronic
1125431660 15:39601521-39601543 AAGTGGAATTGCCAGGTCTATGG - Intronic
1125456540 15:39865822-39865844 AAGTGGGATTGCTGGGTCAAAGG - Intronic
1126251896 15:46577174-46577196 GAGTGCAATTGCTAGGTCATAGG - Intergenic
1127163074 15:56211984-56212006 AAGTGCAATTGCTGGGTCATAGG - Intronic
1127337245 15:58000215-58000237 AAGTGAGATTACAAGGTCTAGGG - Intronic
1127917525 15:63467341-63467363 AAGTGGTATTCCAAGGTCAAAGG - Intergenic
1128088382 15:64901793-64901815 AAGTGCAATTGCTGGATCAATGG - Intronic
1128329049 15:66744050-66744072 AAGTGGGATTGCCAGGTCAAAGG + Intronic
1130374362 15:83315004-83315026 AAGTGATATTGCAGAGTCAAAGG + Intergenic
1131193531 15:90336506-90336528 AAGTGGAAATGCTAGGTCAAAGG + Intergenic
1131532149 15:93202954-93202976 AAGAGCCATCAGAAGGTCAAAGG - Intergenic
1131818882 15:96251310-96251332 AAGGGGAATTGCATGGTCAAAGG + Intergenic
1132425879 15:101716703-101716725 AAGTACAACTGCTAGGTCAAGGG + Intronic
1133107545 16:3522593-3522615 GAGTGCCACGGCAAGGTCAGAGG + Intronic
1133122859 16:3621856-3621878 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1134177179 16:12016795-12016817 AAGTGGGATTGCTGGGTCAAAGG + Intronic
1134782913 16:16914905-16914927 AAGTGGCATTGGCAGGTCAAAGG - Intergenic
1135128936 16:19835918-19835940 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1135618986 16:23936895-23936917 AAGTGCTATTTCTTGGTCAAGGG + Intronic
1135787485 16:25363296-25363318 TAGTGGCATTGCTGGGTCAAAGG + Intergenic
1136718322 16:32301972-32301994 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136723291 16:32340157-32340179 CAGTGCCAGGGCAAGGACAAGGG + Intergenic
1136773638 16:32860174-32860196 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136836696 16:33508242-33508264 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1136862684 16:33712768-33712790 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1136896973 16:34001345-34001367 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1137873814 16:51976233-51976255 AAGTGAAATTGCTGGGTCAAAGG - Intergenic
1138435014 16:56993487-56993509 GAGTGGATTTGCAAGGTCAAGGG + Intronic
1140129668 16:72149379-72149401 AAGTGTGATTGCTGGGTCAAAGG - Intronic
1203003141 16_KI270728v1_random:177608-177630 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203008106 16_KI270728v1_random:215793-215815 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203076057 16_KI270728v1_random:1122285-1122307 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203124160 16_KI270728v1_random:1560910-1560932 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1203134746 16_KI270728v1_random:1714014-1714036 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1203146882 16_KI270728v1_random:1808543-1808565 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1144343273 17:14328517-14328539 AAGAGACATGGCAATGTCAATGG - Intronic
1148281190 17:46348681-46348703 AAGTGCCAGTCCAAGATAAATGG + Intronic
1148303418 17:46566616-46566638 AAGTGCCAGTCCAAGATAAATGG + Intronic
1149234961 17:54578694-54578716 AAGTGCCATTTAAAGGTCAGGGG - Intergenic
1150351798 17:64450966-64450988 AATTGAAATTGCAAGGTCATAGG + Intronic
1150584989 17:66509367-66509389 AAGTTCCAGTCCAAGCTCAAAGG + Intronic
1150835687 17:68562157-68562179 AAGTGAAATTGCTAAGTCAAAGG - Intronic
1151809297 17:76427840-76427862 AAGAGCCATTCCCAGGTAAAAGG - Intronic
1152439789 17:80299373-80299395 AAGTGGAACTGCTAGGTCAAAGG + Intronic
1153754736 18:8269494-8269516 AAATGCCATTGGAATTTCAATGG - Intronic
1155781701 18:29845514-29845536 AACTGCCTTTTCAATGTCAATGG + Intergenic
1156339010 18:36194561-36194583 AAGTGGAATTGCTAGGTCAAAGG + Intronic
1157786217 18:50485395-50485417 AACTGCAATTGCTAGGTCAAAGG - Intergenic
1158460103 18:57639001-57639023 AAGTGTGATTGCCAGGTCAAAGG + Intergenic
1158623699 18:59053684-59053706 AACTGGAATTGCTAGGTCAAAGG + Intergenic
1158886097 18:61828983-61829005 AAGTACCATTTCAATGTCAAGGG + Intronic
1161157841 19:2742663-2742685 AAGTTCCATAGCACGGTCTATGG - Intergenic
1164158155 19:22608751-22608773 AAGTGGGATTGCCAGGTCTAAGG + Intergenic
1165082274 19:33315195-33315217 AAGTGGAATTGCAAGTTGAAAGG - Intergenic
1167135836 19:47614905-47614927 AAGTGGGATTGCTAGATCAAGGG + Intronic
926283820 2:11471779-11471801 AATTGCCATTGTCAGGCCAATGG - Intergenic
926459079 2:13105681-13105703 AAGTGGGATTGCAGGGTCAAAGG + Intergenic
927731964 2:25481565-25481587 AAGTGCCCTAGCAAGGCTAAAGG + Intronic
927754640 2:25698832-25698854 AAATGCCTTAGCAAGATCAAGGG + Intergenic
927885994 2:26719207-26719229 AAGTGCCACTGCAGGGCCACTGG + Intronic
928433297 2:31238035-31238057 AAGTGGAATTGCTAGGCCAAAGG + Intronic
929249773 2:39739924-39739946 AAGTGAGATTGCTGGGTCAAAGG - Intronic
929880119 2:45829201-45829223 AAGTGGAATTGCAAGATTAAAGG + Intronic
930599857 2:53430577-53430599 AATGGCCATTGCAAGGTCCTAGG - Intergenic
930790415 2:55321202-55321224 CAGTGAAATTGCAAGGCCAAAGG - Intronic
930869665 2:56157208-56157230 AAGTGCCACTGCCAAGTGAATGG - Intergenic
931448097 2:62344119-62344141 AAGTGGAATTGCTAGGTCAAAGG + Intergenic
932069538 2:68604936-68604958 ATGTGGGATTGCTAGGTCAAGGG + Intronic
933814910 2:86058786-86058808 AAGTACAATTGCTGGGTCAAAGG - Intronic
934086032 2:88510433-88510455 AAGTGTAATTGCTATGTCAAAGG + Intergenic
934322811 2:91983357-91983379 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
934461121 2:94214153-94214175 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
934500228 2:94854457-94854479 AAGTGACATTCCAATGTCAGAGG - Intergenic
934965763 2:98720433-98720455 AAGTCCCAGTTCAAGTTCAAAGG - Intronic
935000368 2:99008647-99008669 AAGTGGGATTGCTGGGTCAATGG - Intronic
935225900 2:101052813-101052835 AAGTGGTATTGCAAGATAAATGG - Intronic
936224640 2:110636962-110636984 AAGTGAAATTGCTGGGTCAAAGG - Intergenic
936716034 2:115188779-115188801 AAGTGTGATTGCTGGGTCAAGGG - Intronic
937814322 2:126234380-126234402 AAGTGACATTGCTGGGCCAAAGG + Intergenic
939127387 2:138193674-138193696 AGGTGATATTGCAAGGTAAATGG + Intergenic
940171950 2:150838342-150838364 AAGTGCTTTTGCATGGTAAAAGG - Intergenic
940306631 2:152233980-152234002 AAGTGGGATTGTTAGGTCAAAGG + Intergenic
940956555 2:159734928-159734950 GAGTGCAATTGCATGATCAAGGG - Intronic
941434245 2:165448947-165448969 AAGTGAAATTACTAGGTCAAAGG + Intergenic
941652265 2:168104782-168104804 AACTGGAAATGCAAGGTCAAAGG - Intronic
942849474 2:180466815-180466837 AACTGCCATTGCAAGGACATTGG + Intergenic
943712955 2:191118190-191118212 AAGTGAAATTGCTATGTCAAAGG - Intronic
944108931 2:196110533-196110555 AAGTAGAATTTCAAGGTCAAAGG - Intergenic
944368717 2:198955640-198955662 AAATTCCAGTGCAAGTTCAAAGG - Intergenic
945213699 2:207411303-207411325 GAGTGCCATAGCAAGGTCACTGG + Intergenic
945411273 2:209511447-209511469 AAGTGCAATTGCAAAGGCAGGGG - Intronic
947571326 2:231237487-231237509 AAGTGGAATTGCTAGGGCAAAGG + Intronic
948500247 2:238387548-238387570 AAGTGGCATTACTGGGTCAAAGG - Intronic
948539658 2:238680733-238680755 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
948555321 2:238806134-238806156 AAGTGCCCTGGCATGGTCAGGGG + Intergenic
1168934033 20:1647530-1647552 AAGTGACATTGCTAAGTCAGAGG - Intronic
1168937280 20:1676269-1676291 AGGTGGCATTGCTAGGTCAGAGG - Intergenic
1168941962 20:1720397-1720419 AAGTGACATTGCCGGGTCACAGG - Intergenic
1168968813 20:1916833-1916855 AAGTGCCATTGCTAGATCAGAGG + Intronic
1169393651 20:5211183-5211205 AAGTGCCAAGGCAGAGTCAAAGG + Intergenic
1169783409 20:9333004-9333026 AAGTGCAATTACAAGGGCACTGG - Intronic
1170085136 20:12523022-12523044 AGGTGCCATTGCAATGTGATGGG + Intergenic
1170674910 20:18470006-18470028 AAATTCCATTGCAATGTCACTGG - Intronic
1172171063 20:32932799-32932821 AAGTGGGATTGCTAGGTAAAAGG + Intronic
1174294466 20:49535321-49535343 AAGTGGTTTTGCCAGGTCAAAGG - Intronic
1174651580 20:52130149-52130171 AAGTGCCATGGCAGGGTGGAGGG - Intronic
1175805258 20:61824464-61824486 AAGTGTCATTACAGGGTCACAGG + Intronic
1175876244 20:62231582-62231604 AGGTGCCATGCCAAGGGCAAGGG - Intergenic
1176592237 21:8657175-8657197 CAGTGCCATGGCAAGGGCAAGGG - Intergenic
1176868273 21:14067805-14067827 AAGTGGCATTCCAATGTCAGAGG + Intergenic
1177415341 21:20785799-20785821 AAGAGCAATTGCAAAGGCAAGGG + Intergenic
1178069603 21:28948904-28948926 AAGTGGAATTGAAAGCTCAAAGG + Intronic
1178276207 21:31239944-31239966 GAGTGGCATTGCAGGGTCATGGG - Intronic
1179158169 21:38869284-38869306 AACTGCTATTGCAAGAACAAAGG - Intergenic
1180012786 21:45062305-45062327 AAGTCTCAGTTCAAGGTCAAAGG - Intergenic
1180275088 22:10634304-10634326 CAGTGCCATGGCAAGGGCAAGGG - Intergenic
1180549571 22:16529255-16529277 CAGTGCCAGGGCAAGGACAAGGG - Intergenic
1181355121 22:22292573-22292595 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1182026854 22:27126252-27126274 AACTGGAATTGCCAGGTCAAAGG + Intergenic
1184702822 22:46188345-46188367 AAGGGCCATTTCAAGGAAAAGGG - Intronic
951321995 3:21255868-21255890 AAGTGGAATTGCTATGTCAAAGG + Intergenic
951935701 3:28020568-28020590 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
952985661 3:38779062-38779084 AAGTAGAATTGCCAGGTCAAAGG - Intronic
953140119 3:40221762-40221784 AAGTACAATTGCCAGATCAAAGG - Intronic
953408395 3:42672159-42672181 CAGTGTCTTTGCAAGGTGAAAGG - Intergenic
953778439 3:45843125-45843147 AAATGCCATTGCAGTGCCAAGGG - Intronic
954573470 3:51661513-51661535 AAGTGGGATTGCCAGGTCAAAGG + Intronic
956133712 3:66078278-66078300 AAGTGTCATTTCCAGGTAAAAGG - Intergenic
956424839 3:69123333-69123355 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
956476021 3:69621244-69621266 AACTGCCACTACAAGGTAAAGGG + Intergenic
956859157 3:73305451-73305473 AAGTAGAATTGCAAGGCCAAAGG + Intergenic
959827528 3:110816418-110816440 ATGTTCCATTGCCAGCTCAATGG - Intergenic
960258895 3:115542547-115542569 AAAGACCTTTGCAAGGTCAAAGG + Intergenic
962387602 3:134944788-134944810 AAGTGGAATTGCTGGGTCAAAGG + Intronic
962544982 3:136424772-136424794 AATTGGTATTGCTAGGTCAAAGG - Intronic
963039805 3:141060641-141060663 AAGTAGAATTGCTAGGTCAAAGG + Intronic
963129612 3:141846161-141846183 AAGTGGCATTGCTGGGTTAAAGG - Intergenic
963197297 3:142546365-142546387 TAGTGACATGGCAAGGTTAAGGG - Intronic
964294506 3:155218803-155218825 AAGTGACCTTGCTAAGTCAAAGG + Intergenic
964345173 3:155747904-155747926 AAATGCCATTGAATGGTGAAAGG + Intergenic
967323396 3:188215882-188215904 AAATGCCATAGCAAGGTGTAAGG - Intronic
967693639 3:192506126-192506148 CAGAGCCAGTGCATGGTCAATGG + Intronic
970609976 4:17716195-17716217 GAGTGCCCTTGCATGGTCAGTGG - Intronic
970627131 4:17898843-17898865 AAATGGGATTGCTAGGTCAAAGG + Intronic
972334914 4:38099112-38099134 AAATGGCATTGCCGGGTCAAAGG - Intronic
972721689 4:41705850-41705872 AAGTGAAATTGCTATGTCAAGGG - Intergenic
973197198 4:47459387-47459409 AAGTGAAATTGCATGGTCATAGG - Intronic
973310568 4:48705151-48705173 AAGTGGAATTGCAGGGCCAAAGG - Intronic
973337079 4:48967569-48967591 TAGTTCCTTTGCAAGGTGAATGG + Intergenic
975727416 4:77305631-77305653 AAGTGCCTTGGCAAGGCCGATGG + Intronic
976003859 4:80404161-80404183 AAGTGAAATTGCTGGGTCAATGG + Intronic
976307697 4:83577664-83577686 AAGTGGAATTGCTAGGTCATAGG + Intronic
976735648 4:88306193-88306215 AAGGGCCATTGTAGAGTCAATGG - Intergenic
978168517 4:105638950-105638972 AAGTGAAATTGCTAGATCAAAGG + Intronic
978197645 4:105989794-105989816 AGGTGGCATTGCCAGGTCAAAGG - Intronic
980961286 4:139478916-139478938 AAGTGACATTGCTAGATGAAAGG + Intergenic
981148849 4:141357575-141357597 AAGGGCCATGGCAATGTCCAAGG - Intergenic
981231938 4:142366928-142366950 TAGAGCCATAGGAAGGTCAAAGG + Intronic
982423834 4:155233146-155233168 TATTGCCATTGCAGGGTTAAAGG - Intergenic
983663970 4:170161733-170161755 AGGTGGGATTACAAGGTCAAAGG + Intergenic
984467087 4:180113511-180113533 TAGTGCCATTGACAGGTTAATGG - Intergenic
986719958 5:10553784-10553806 AAGTCCTAGGGCAAGGTCAAAGG + Intergenic
988445014 5:31276002-31276024 ATGTGCCATTGCAACCTCGAGGG + Intronic
988705224 5:33719456-33719478 AAATGGAATTGCTAGGTCAAAGG - Intronic
989500045 5:42156068-42156090 AAGTGAGGTTGCTAGGTCAAAGG + Intergenic
989648529 5:43663271-43663293 AAGTGCAATTACATGGTCAAAGG + Intronic
990059997 5:51635991-51636013 AAGTGCAATTACAGGGTCAAAGG - Intergenic
990858080 5:60293955-60293977 GAGTGGAATTGCTAGGTCAAAGG + Intronic
991556979 5:67906491-67906513 AAGTGCCATTGACAGATGAATGG + Intergenic
991583939 5:68183729-68183751 AAGTATCAATTCAAGGTCAAAGG + Intergenic
994435524 5:99726139-99726161 AAGTGCCATTGCAATTTTGATGG - Intergenic
996445044 5:123538197-123538219 GAGTGGCATTGCTAGGTCATAGG + Intronic
997015839 5:129933996-129934018 AAGTGGCATTGTTAGGTCAAAGG - Intronic
997258936 5:132450559-132450581 AAGTGAAATTGCGTGGTCAAAGG - Intronic
997930001 5:138064939-138064961 AAGTGCCATTGGAAGCTAAAAGG - Intergenic
997952819 5:138255535-138255557 TAGTACCATTGCCAGATCAAAGG - Intronic
998241392 5:140448400-140448422 AAGTGGAATTGCTGGGTCAAAGG + Intronic
998681265 5:144470243-144470265 CAGTGGGACTGCAAGGTCAAAGG + Intronic
998795506 5:145813862-145813884 AAGTGAGATTTCATGGTCAAAGG - Intronic
998948632 5:147368137-147368159 CATTGCCATTGCAAAGGCAAAGG + Intronic
999615621 5:153419788-153419810 AAGTGGCATTGCTGGGTCAAAGG - Intergenic
1000003786 5:157164628-157164650 AAGTGGGATTGCACAGTCAAGGG + Intronic
1000193135 5:158932144-158932166 AAGTGCAATTACAGGCTCAAAGG - Intronic
1000473486 5:161676033-161676055 AAGTGCCTTGGAAAGGTCAGAGG - Intronic
1001974129 5:175982847-175982869 AAGTGAAATTGCTAGATCAATGG - Intronic
1002243305 5:177860932-177860954 AAGTGAAATTGCTAGATCAATGG + Intergenic
1002916374 6:1531191-1531213 AAGTGGGATTGCTAGGTCAAAGG + Intergenic
1003048407 6:2757448-2757470 AAATGTGATTGCAGGGTCAAAGG - Intergenic
1003562128 6:7189495-7189517 AAGTGCCTTGGCAAGGTCTGTGG + Intronic
1006567323 6:34971034-34971056 AAGTTACATTGCCATGTCAATGG - Intronic
1006912390 6:37571873-37571895 GAGGGCCAATGCAAGGTCAGAGG - Intergenic
1008091649 6:47299940-47299962 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1009423656 6:63490820-63490842 AAGTCCCATTCCAAGCCCAAAGG + Intergenic
1013588266 6:111598306-111598328 AAGTGAAATTACTAGGTCAAAGG - Intronic
1014695769 6:124619487-124619509 AAATGAAATTGCCAGGTCAAAGG - Intronic
1015689598 6:135907015-135907037 AAATGACATGGCAAGGTCAGAGG + Intronic
1015785477 6:136918556-136918578 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1016177157 6:141095077-141095099 AAGTGCTATTGCTGTGTCAAAGG + Intergenic
1018501678 6:164417816-164417838 AAGCAACATTGCAAGGTGAAGGG + Intergenic
1019426317 7:978813-978835 AAGTGCAAGTGCAAGTTCACGGG - Intergenic
1020691730 7:11363616-11363638 AAGTGGAATTACATGGTCAAAGG + Intergenic
1021285721 7:18778863-18778885 AATTGCACATGCAAGGTCAATGG + Intronic
1022763830 7:33387242-33387264 AAGTGGGATTGTTAGGTCAAAGG + Intronic
1023299561 7:38755060-38755082 AAGAGCCATTGTAAAGCCAAGGG - Intronic
1023304305 7:38807846-38807868 AAGTGTCATTGCCAGTTCAGAGG - Intronic
1023910877 7:44555541-44555563 AAGGGTCAAAGCAAGGTCAAAGG + Intergenic
1024469176 7:49749317-49749339 AAAAGCCACTGCAAGGTGAAAGG + Intergenic
1025614687 7:63107477-63107499 AGGTGGAATTGCTAGGTCAAAGG - Intergenic
1027303067 7:76861861-76861883 AAGTGTTATTTCAAAGTCAAGGG - Intergenic
1028434709 7:90789048-90789070 AAGTGCCATTGCAAGGTCAAAGG - Intronic
1029660364 7:101956596-101956618 AAGTGGGATTGCTGGGTCAAAGG - Intronic
1031381886 7:121096540-121096562 ATGTGTAATTGCCAGGTCAATGG - Intronic
1031398313 7:121300739-121300761 AAGTTCCATTTCAAAGGCAAAGG - Intergenic
1032373143 7:131380347-131380369 AAGTGCCCTTGCTATGTGAAAGG + Intronic
1032444831 7:131973282-131973304 ATGTGACCTTCCAAGGTCAACGG + Intergenic
1034127527 7:148687019-148687041 AAGTGCCCTTGCACTGTCCAAGG + Intergenic
1034195762 7:149245819-149245841 AAGTGGGATTGCTAGGTAAAAGG + Intronic
1034827022 7:154275063-154275085 AAGTGCCAATGAAAGGACACAGG - Intronic
1035223969 7:157423641-157423663 AAGTGGGATGGCCAGGTCAAAGG + Intergenic
1038336039 8:26646282-26646304 AAGTGGCATTGCTGGGTCAAAGG + Intronic
1038822185 8:30962784-30962806 ACTTGCCAATGCAAAGTCAATGG - Intergenic
1038911111 8:31965573-31965595 TAGTGGTATTGCTAGGTCAATGG + Intronic
1039664977 8:39516295-39516317 AAATGCCATCGGAATGTCAATGG + Intergenic
1039861600 8:41463766-41463788 AAGTGAAATTGCTGGGTCAAAGG - Intergenic
1042641773 8:70943588-70943610 AAGTGACAATGCAAGGTAATAGG + Intergenic
1043702553 8:83308774-83308796 AAATGGCAATGCTAGGTCAATGG + Intergenic
1044329398 8:90898964-90898986 AAATGCCCTTGGAAGGTAAAGGG + Intronic
1044830952 8:96248196-96248218 AAGTGGAAATGCTAGGTCAAAGG - Intronic
1045008061 8:97933166-97933188 AAGTGGCATGGCAAGGAAAAAGG - Intronic
1045024053 8:98069727-98069749 GAGTGGCATTACTAGGTCAAAGG + Intronic
1045237799 8:100370983-100371005 CTAGGCCATTGCAAGGTCAAGGG + Intronic
1045290541 8:100828894-100828916 AAATGCCATGGCAATGTCAGGGG + Intergenic
1045342948 8:101270562-101270584 AAGTTCCAGTTCAAGGACAAAGG - Intergenic
1047224053 8:122942021-122942043 AATTGCCTTTGAAAGGTCACTGG - Intronic
1047434942 8:124828464-124828486 AAATGAAATTGCTAGGTCAAAGG + Intergenic
1047721360 8:127643471-127643493 AAGAGCCATGGAAAGGTCAATGG - Intergenic
1048225100 8:132577637-132577659 AAGTGCCATGTCAATGTCAGTGG - Intronic
1048833082 8:138495558-138495580 AAGAGCCCTTTCAAAGTCAATGG + Intronic
1051307668 9:15731718-15731740 AAGTGCAGTTGCCAGGTCATGGG + Intronic
1051325535 9:15963459-15963481 CAGTGGAATTGCTAGGTCAAAGG + Intronic
1053656942 9:40226083-40226105 AAGTGGCATTCCAATGTCAGAGG + Intronic
1053691605 9:40589813-40589835 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1053907308 9:42855369-42855391 AAGTGGCATTCCAATGTCAGAGG + Intergenic
1054273197 9:63047672-63047694 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054302861 9:63390779-63390801 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054369058 9:64372358-64372380 AAGTGGCATTCCAATGTCAGAGG + Intronic
1054401642 9:64717295-64717317 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054435245 9:65201604-65201626 CAGTGCCAGGGCAAGGGCAAGGG - Intergenic
1054495145 9:65820077-65820099 CAGTGCCAGGGCAAGGGCAAGGG + Intergenic
1054527658 9:66150146-66150168 AAGTGGCATTCCAATGTCAGAGG - Intronic
1054676690 9:67862112-67862134 AAGTGGCATTCCAATGTCAGAGG + Intronic
1055158320 9:73093284-73093306 ATGATCCATAGCAAGGTCAAAGG - Intergenic
1057362570 9:94388380-94388402 AAGAGTGATTGCCAGGTCAATGG - Intronic
1057754704 9:97822949-97822971 AAGTGGAATTGCTAGGTCATAGG - Intergenic
1058061122 9:100497120-100497142 AAGAGCTAAAGCAAGGTCAAGGG + Intronic
1059058304 9:111007740-111007762 AAGTAGGATTGCTAGGTCAAAGG - Intronic
1059703510 9:116798656-116798678 AAGTCCCATTGCTATCTCAAAGG - Intronic
1060370505 9:123065580-123065602 AAAAGACATTGCAAAGTCAAAGG + Intronic
1060982027 9:127798399-127798421 AAGTGCAATTGCTGGGTCAAAGG - Intronic
1203622290 Un_KI270749v1:136022-136044 CAGTGCCATGGCAAGGGCAAGGG - Intergenic
1186614132 X:11169059-11169081 AAGTGGCATGGGAAGGACAAAGG + Intronic
1186841725 X:13491326-13491348 AAGTGGCATTGCTAGGTGGAAGG - Intergenic
1186886366 X:13918219-13918241 AAGTGCAATTGCAAGTGCAGGGG - Intronic
1187441563 X:19325472-19325494 AAGTGGAATTGCTAGGTCAATGG - Intergenic
1189963038 X:46343206-46343228 ATGTGGGATTGCTAGGTCAAGGG + Intergenic
1190189738 X:48267523-48267545 AAGTGGAATTGCCATGTCAAAGG + Intronic
1190405426 X:50081951-50081973 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1190752961 X:53378185-53378207 AAGTGGAATTGCAAAGTCATAGG - Exonic
1191654219 X:63578015-63578037 AAGAGCCAGTGCAAGGTCTCTGG + Intergenic
1191754365 X:64578191-64578213 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
1192779518 X:74279925-74279947 AAGTCCCATTGAAAGGAAAATGG + Intergenic
1193133237 X:77941132-77941154 AAGTGTTATTGCTAGGACAAAGG - Intronic
1195095423 X:101496840-101496862 AAGTGGAATTACAGGGTCAAAGG - Intronic
1196001711 X:110794351-110794373 AAGAGCCAGTGCAAGTTCAATGG - Intronic
1197686953 X:129450521-129450543 AAATGGAATTGCTAGGTCAAAGG - Intronic
1198524128 X:137482990-137483012 AAGTGAGATTACCAGGTCAAAGG - Intergenic
1201945600 Y:19506533-19506555 AAGTGCCATGCCAATGTCTACGG - Intergenic
1202583316 Y:26403382-26403404 CAGTGCCAGGGCAAGGACAAGGG + Intergenic