ID: 1028435460

View in Genome Browser
Species Human (GRCh38)
Location 7:90797963-90797985
Sequence TCACCCTACTTGCAAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028435460 Original CRISPR TCACCCTACTTGCAAAAAAT AGG Intronic
901624145 1:10614043-10614065 GCACCAGACTTGGAAAAAATAGG + Intronic
906071032 1:43016548-43016570 TGACCCTAGTTGGACAAAATAGG + Intergenic
907427688 1:54391233-54391255 TCACCCAACTTCCAAAAAGCTGG + Intronic
910998615 1:93136949-93136971 TCACCCGACGTGCCAAAACTCGG - Exonic
912312553 1:108638304-108638326 TCTCCCTTCTAGCAACAAATTGG - Exonic
913452621 1:119002261-119002283 TCACCCCAGTTGGACAAAATAGG - Intergenic
915989980 1:160504271-160504293 TTACCATACTTGCACAAAAAGGG + Intronic
917954451 1:180078773-180078795 TCACCATACTTGTAACATATAGG + Intronic
921764217 1:218951728-218951750 TAACCCAAATTGAAAAAAATAGG - Intergenic
922201631 1:223407415-223407437 TACCCCTATTTGCAAATAATAGG + Intergenic
1064013455 10:11754954-11754976 TCACCCTTCTTCCATAGAATCGG + Intronic
1065823389 10:29547889-29547911 TCATCCTACTTGCAAAACACAGG + Intronic
1070476467 10:76834155-76834177 TTTCCCTGCTTGAAAAAAATGGG - Intergenic
1070728843 10:78811010-78811032 CCACCCTACCTGCATCAAATAGG + Intergenic
1073854284 10:107656840-107656862 TGACCCTTCTTGGAAAAAAATGG - Intergenic
1074294313 10:112169619-112169641 TCACTCTACTTGAAAAGAATAGG - Intronic
1076945784 10:133648848-133648870 TCACTCTCCTTGCAAAGAGTCGG + Intergenic
1079920835 11:26432420-26432442 TCACACTAAAAGCAAAAAATTGG - Intronic
1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG + Intergenic
1088046208 11:105455384-105455406 TCTCCCTATTTCCAAAATATTGG + Intergenic
1098203327 12:68080184-68080206 TCACCCAAATTGAAGAAAATAGG - Intergenic
1106249287 13:27971683-27971705 TTTCCCTCATTGCAAAAAATGGG + Intergenic
1110573311 13:77028701-77028723 TCACCCAACTTTAAATAAATGGG - Intergenic
1113637535 13:111930014-111930036 TTACTCTACTTGTAAAAAATTGG - Intergenic
1120268672 14:82282590-82282612 CCACTCTACTTGCAACAACTAGG + Intergenic
1122057171 14:99108394-99108416 TCCAACTACTTGAAAAAAATTGG - Intergenic
1202925029 14_KI270724v1_random:16197-16219 TCACTCTCCTTGCAAAGAGTCGG - Intergenic
1126424653 15:48514244-48514266 TGACCCTACTTGTAAACAAGAGG + Intronic
1128166155 15:65466708-65466730 TGACCCAACTTGCAAAACAAAGG - Exonic
1137395438 16:48113695-48113717 TCTTCCAACTTGCAAAAAGTTGG + Intronic
1138249557 16:55491585-55491607 TGACCCCACTTGGAAACAATAGG + Intronic
1139835880 16:69838245-69838267 TCTCCCTACCTGCAAAACAGGGG - Intronic
1140262893 16:73396028-73396050 TCACCCTACCTGGAATAAATAGG + Intergenic
1140623604 16:76766057-76766079 TCCTCCTTCTTGCCAAAAATTGG - Intergenic
1140634669 16:76898111-76898133 AAACCCTCCTTGCAAAAAGTTGG - Intergenic
1141413064 16:83849355-83849377 TAACCCCACTTTTAAAAAATGGG - Intergenic
1144558885 17:16305548-16305570 TAACCCTACTTGCAACAGAAAGG + Intronic
1146585736 17:34079958-34079980 TTACCCTACATGCAAGAAGTTGG - Intronic
1148222532 17:45873505-45873527 TCTTTCTACTTGCTAAAAATGGG - Intergenic
1152028688 17:77827850-77827872 TCACCCTATTGGGAAAAAAAGGG + Intergenic
1153930963 18:9879311-9879333 TCACCCTATTTCCAAAAACGAGG + Intergenic
1154337407 18:13476643-13476665 TCATATTTCTTGCAAAAAATGGG + Intronic
1158368970 18:56775358-56775380 TCATCCTCCATGCAAAAAGTTGG - Intronic
930964419 2:57304358-57304380 TCACACTATTTGCCAAAAAGTGG + Intergenic
932946076 2:76232988-76233010 TAACCCTACTAAAAAAAAATGGG - Intergenic
933177337 2:79190478-79190500 TCACCATACTTGGACACAATAGG + Intronic
933309435 2:80641945-80641967 TCACCCTACATGAAACAATTGGG + Intronic
936382574 2:111999891-111999913 ACCCCCTGCTTACAAAAAATTGG - Intronic
938545058 2:132321053-132321075 TCCTCCTACTTGCAAACAGTAGG + Intergenic
938706511 2:133933715-133933737 TCACCATATTTGCAGAAAAGTGG - Intergenic
941308057 2:163894891-163894913 TCACCTAACCTGCAAAACATTGG - Intergenic
943373920 2:187052001-187052023 TCTCCCTAAATTCAAAAAATTGG - Intergenic
945298957 2:208198269-208198291 ACAACCTAATGGCAAAAAATGGG - Intergenic
946380689 2:219346711-219346733 TCACGCTACTTACAGAAAAAGGG - Intergenic
946750659 2:222892895-222892917 TCACCAAGCTTGCAATAAATGGG - Intronic
1170174119 20:13448835-13448857 TCAGCCTACTCCCAAAAAACAGG + Intronic
1171163994 20:22954777-22954799 TCACCCTTACTGCAAACAATGGG - Intergenic
1171783764 20:29444911-29444933 TCACTCTCCTTGCAAAGAGTTGG + Intergenic
1171873920 20:30553836-30553858 TCCTCCTACTTGCAAACAGTAGG + Intergenic
1171987855 20:31673002-31673024 TCACACTACTTGGAAGAAGTGGG - Intronic
1181841838 22:25669973-25669995 GCACCATACTTTTAAAAAATAGG + Intronic
1183416502 22:37685607-37685629 TCACCCTATTTGTAAAATAAGGG - Intronic
949315835 3:2753981-2754003 ACAGCCTACTTGCAATAAATTGG - Intronic
951376967 3:21930445-21930467 TCACTCTAATTTCAAAAATTTGG + Intronic
951862772 3:27272467-27272489 TCACTCTTCCTGCAAAAAAGGGG + Intronic
955834725 3:63042269-63042291 TCAAACTACTTGAAGAAAATGGG - Intergenic
956969437 3:74505179-74505201 TGACCCTATTTTCAAATAATAGG + Intronic
957028978 3:75218083-75218105 TCATCCCATTTTCAAAAAATGGG + Intergenic
957081698 3:75641622-75641644 TCACTCTCCTTGCAAAGAGTCGG - Intergenic
958653253 3:96965332-96965354 TAACAATACTTGAAAAAAATTGG + Intronic
959554561 3:107701567-107701589 TCACACTACTAGCATGAAATTGG - Intronic
960965911 3:123104603-123104625 TCTCCCCACTGGCAAAGAATAGG + Intronic
965501428 3:169460695-169460717 TCAGTCTCCTTGCAAGAAATTGG + Intronic
969143983 4:5103945-5103967 TCAACCTATTAGAAAAAAATAGG - Intronic
971725789 4:30310061-30310083 TCACCCAACAGGCAACAAATAGG - Intergenic
971988980 4:33866317-33866339 TCCCCCTCCCTGCAAAAAAAAGG + Intergenic
972231023 4:37072970-37072992 TCAGCCTCTATGCAAAAAATAGG + Intergenic
977594191 4:98860094-98860116 TCAGCAAACATGCAAAAAATTGG + Intergenic
978920742 4:114180154-114180176 TCATCCCCCTTCCAAAAAATAGG - Intergenic
981858611 4:149326681-149326703 TCACCCTACTTCCTGAAGATAGG + Intergenic
982395510 4:154911148-154911170 TCACACTATTAGCCAAAAATGGG - Intergenic
983127395 4:163971136-163971158 TACTCCTACTTGCAAATAATAGG - Intronic
984951437 4:185010727-185010749 TCACCCTACATGGCAAAAAAAGG + Intergenic
985449172 4:190049358-190049380 TCACTCTCCTTGCAAAGAGTCGG + Intergenic
991971974 5:72150078-72150100 TCAGCCCAATTTCAAAAAATGGG - Intronic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
993885850 5:93414140-93414162 TAACCTTACTTGAAAAGAATTGG + Intergenic
994911385 5:105913471-105913493 TCACTCTACTTTTAAAAAACTGG - Intergenic
999850981 5:155538472-155538494 TCTTCCCACTAGCAAAAAATTGG - Intergenic
999853967 5:155573216-155573238 TGACCCTCCTTGCCATAAATGGG + Intergenic
1000568599 5:162882694-162882716 TCACCAAACTGGGAAAAAATAGG + Intergenic
1010073610 6:71773437-71773459 TCCCCATATTTGTAAAAAATTGG + Intergenic
1012378030 6:98586000-98586022 TCACCCCACTTCCCTAAAATAGG - Intergenic
1012570456 6:100719837-100719859 TCTCCCTACTTACTAAAAGTAGG + Intronic
1013985742 6:116191118-116191140 ACACCCTACATTAAAAAAATTGG - Intronic
1016705344 6:147100556-147100578 TGTTCCTACTTCCAAAAAATAGG - Intergenic
1017959886 6:159212521-159212543 TCAAAATACTTGAAAAAAATGGG + Intronic
1024836490 7:53525811-53525833 ACACGCAACTTGCATAAAATGGG - Intergenic
1028435460 7:90797963-90797985 TCACCCTACTTGCAAAAAATAGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033396222 7:140976354-140976376 CCACCCTATTTTCAAATAATGGG + Intergenic
1033904462 7:146184829-146184851 ACTCCCTAATTGCAAAAAAGTGG + Intronic
1034366673 7:150555700-150555722 AAAACCTACTTGCTAAAAATAGG + Intergenic
1034681138 7:152928771-152928793 TCACCCTCCTTACAAAAGATAGG - Intergenic
1037065990 8:14578093-14578115 TCACCCAACTTTGATAAAATAGG - Intronic
1041736059 8:61111756-61111778 TTACCCTTCTTTAAAAAAATTGG + Intronic
1043417994 8:80071322-80071344 GCCCCTTACCTGCAAAAAATGGG + Intronic
1043838542 8:85073468-85073490 TTACACTACTTGCCAAAAGTAGG + Intergenic
1046060330 8:109131959-109131981 TCACCCCTCTTGCTAAAAAAAGG + Intergenic
1047076523 8:121410502-121410524 TCACCCAACTAGTAAAACATGGG + Intergenic
1050724747 9:8636091-8636113 TCACACTACTTGTAAAACACAGG + Intronic
1055702849 9:78964824-78964846 TCACCACACTTGTAAAAAACAGG + Intergenic
1057887063 9:98838024-98838046 TCACCCTACTGGCTACAAAGAGG - Intronic
1059300579 9:113309725-113309747 TCACCCTACATGAAAAACACAGG - Intergenic
1059591663 9:115669073-115669095 CCAGCCTACTTGCCAAAAAATGG + Intergenic
1060577549 9:124710735-124710757 TAAGCCTAGTTGCCAAAAATGGG + Intronic
1203444395 Un_GL000219v1:41827-41849 TCACTCTCCTTGCAAAGAGTCGG + Intergenic
1188360826 X:29251100-29251122 TCAACCTAGTTGCAAAACAGGGG - Intronic
1188649785 X:32618022-32618044 TCAGCTTACTTGCAAAGAAAAGG + Intronic
1193093230 X:77517390-77517412 ACAAACTACATGCAAAAAATTGG + Intronic
1197032132 X:121829048-121829070 TCTGCCAACTTGTAAAAAATAGG - Intergenic
1198027485 X:132721833-132721855 TTACCCTTCTTGCAAAAAAGAGG + Intronic