ID: 1028435939

View in Genome Browser
Species Human (GRCh38)
Location 7:90803651-90803673
Sequence GTGGCAGTTGTGTGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028435939 Original CRISPR GTGGCAGTTGTGTGACATGG TGG Intronic
900686844 1:3954215-3954237 TAGGCAGATGTGTGCCATGGTGG + Intergenic
901340544 1:8494918-8494940 TTGGCTGTTGGGTGCCATGGGGG - Intronic
901887438 1:12232490-12232512 GTGGCTGATGACTGACATGGTGG + Intronic
902057294 1:13612091-13612113 GGGGCAATTTTGTGACAGGGTGG - Intronic
903885325 1:26537576-26537598 GTGACAGTGGTGTGACCTTGGGG + Intronic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
906745995 1:48222580-48222602 GTGGCAGTTGGGAGAAAAGGAGG + Intergenic
906808231 1:48800988-48801010 GTGGCCGCTGTGGGGCATGGGGG + Intronic
907938660 1:59065938-59065960 GTGGCAGATGAGTCAAATGGTGG + Intergenic
908003368 1:59703508-59703530 GTGGTAGCTGGGTGACATGGTGG - Intronic
908502282 1:64755983-64756005 GAGGCAGTAGTGTGACTTTGAGG - Intronic
909832846 1:80215147-80215169 ATATCAGTTGTGTGACTTGGGGG + Intergenic
910859301 1:91728213-91728235 GTGGCAGTTTGGTGAGTTGGGGG + Intronic
911265891 1:95742840-95742862 GTGGCTGCTGTGGGATATGGGGG + Intergenic
913138055 1:115911923-115911945 GTGGCACTTGAGGAACATGGGGG - Intergenic
914692776 1:150046169-150046191 GTTGCAGTTGTGTGGCATATGGG + Intergenic
916018908 1:160776061-160776083 GGGGCAGTTGTGTCCCATGGGGG - Intergenic
919340179 1:196295883-196295905 GTGTAAGTTTTATGACATGGAGG + Intronic
923050793 1:230390104-230390126 GAGGCTGCTTTGTGACATGGCGG + Intronic
1063160764 10:3416428-3416450 GTGGGAGTTGGGAGCCATGGAGG + Intergenic
1063644813 10:7868468-7868490 GTGGAGGTGGTGTGACATAGCGG + Intronic
1065045104 10:21740165-21740187 GTGGTAGCTGTGTGAAGTGGGGG - Exonic
1065470987 10:26081238-26081260 GTGGCTGCTGTGTGGGATGGGGG + Intronic
1066061048 10:31723970-31723992 GTGGCAGTTGGGGGGCACGGGGG - Intergenic
1066447471 10:35496816-35496838 GAGTCACTTGTGTGACATTGTGG + Intronic
1066524237 10:36258713-36258735 ATGGGTGGTGTGTGACATGGAGG + Intergenic
1067341211 10:45405889-45405911 GTGGCAGGAGTGGGGCATGGTGG - Intronic
1068191890 10:53663235-53663257 GTGGAAGTTGTCTGCCATTGAGG - Intergenic
1068823239 10:61402548-61402570 GTGGCAGTTATGTGTGTTGGGGG + Intergenic
1071015863 10:80996802-80996824 GCAGCTGTTGTGTGAGATGGTGG + Intergenic
1072505530 10:96062657-96062679 GTGGGAGGTGTTTGTCATGGGGG - Intergenic
1072657747 10:97342272-97342294 GTGGCAGCTGTCTGGAATGGAGG - Intergenic
1073689358 10:105790508-105790530 CTGGCAATTGTATCACATGGTGG + Intergenic
1075880388 10:125845969-125845991 GTGGGAGTGATGTGACATGCAGG - Intronic
1076009887 10:126979475-126979497 GTGGCAGTTGTGTCCTATGTAGG - Intronic
1076334442 10:129696051-129696073 GTGTCTGCTGTGTGTCATGGGGG + Intronic
1076666311 10:132094903-132094925 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1080737910 11:35035473-35035495 GAGCCAGTTTTGTGACATGCAGG - Intergenic
1086582891 11:88419974-88419996 GTGGTAGTAGTGTGACATATGGG + Intergenic
1087687538 11:101281529-101281551 GTGTAAATTGTGTGTCATGGGGG + Intergenic
1089355569 11:117849983-117850005 GTGGCATTAGTGTGACCTGAGGG - Intronic
1090081155 11:123613652-123613674 GTGGCAGGTGTGTGCCAGGTGGG + Exonic
1090512617 11:127391980-127392002 TTGGCAGTTGTGGGATACGGTGG + Intergenic
1091947456 12:4561300-4561322 GTGGCAGTAGGTTGACCTGGAGG - Intergenic
1093384625 12:18537062-18537084 GTGGCAGGTTTGGGACAGGGGGG - Intronic
1094034112 12:26048452-26048474 ATGGCATTTGTGTGGAATGGTGG + Intronic
1096250379 12:50028166-50028188 GTGGCAGTGGGATGACAAGGAGG + Intronic
1098500595 12:71187511-71187533 GTGGCTGCTGTGGGAGATGGGGG - Intronic
1101658820 12:106748152-106748174 GTGCCAGCTGTGTGACCTTGGGG - Intronic
1101753480 12:107602613-107602635 TTGGCAGTTGTGTGATCTTGGGG - Intronic
1102144169 12:110642161-110642183 GTGTCACTTGTGTGACATGAGGG - Intronic
1104586488 12:130052132-130052154 GTGGCTGCTGTGTGCCCTGGCGG - Intergenic
1104756611 12:131273567-131273589 GTGGGTGTGGTGTGATATGGAGG - Intergenic
1104756620 12:131273613-131273635 GTGGATGTGGTGTGATATGGAGG - Intergenic
1104776394 12:131392494-131392516 GTGGACGTGGTGTGATATGGAGG + Intergenic
1104776618 12:131393327-131393349 GTGGGTGTGGTGTGATATGGAGG + Intergenic
1104776630 12:131393373-131393395 GTGGGTGTGGTGTGATATGGAGG + Intergenic
1104776723 12:131393733-131393755 GTGGGTGTGGTGTGATATGGAGG + Intergenic
1106476658 13:30104690-30104712 TTGGCACCTGTGTGACAAGGTGG - Intergenic
1107238110 13:38197623-38197645 GTGGGAGTTGTGTCACCTGACGG + Intergenic
1109221087 13:59641699-59641721 GTGGATGTTGTGTGAAATAGCGG - Intergenic
1110661215 13:78060966-78060988 GTGGCTGTTGTGGGGAATGGGGG + Intergenic
1111414862 13:87926916-87926938 TAGGTAGATGTGTGACATGGTGG - Intergenic
1111752055 13:92345479-92345501 GTGGGTGTTGGGTGGCATGGGGG - Intronic
1111933609 13:94536605-94536627 GAGGCAGATGTGTCACATAGCGG - Intergenic
1114995306 14:28343285-28343307 GTGGCTTTTGTGTCACATGGTGG - Intergenic
1117476025 14:56095913-56095935 GTGGCAGAAGTGTGACAAAGAGG - Intergenic
1118141949 14:63093479-63093501 GGGGCAGTCCTGTGAAATGGAGG + Intronic
1120939525 14:89933975-89933997 GAGGCTGTTGTGTGGCAAGGTGG + Intronic
1121888539 14:97567217-97567239 GTGCCAGATGTGAGATATGGAGG - Intergenic
1124845615 15:33287097-33287119 CTGGTAGATGTGTGCCATGGTGG - Intergenic
1126227591 15:46289572-46289594 GTGGCAGTGTTGTGTGATGGTGG + Intergenic
1127525251 15:59786502-59786524 GTGGCTGTTGTGGGGGATGGGGG + Intergenic
1128085630 15:64884366-64884388 GTGGCAGCAGTGTGGCATCGGGG + Intronic
1128339319 15:66809333-66809355 GTGGCATTTGTGTGAGCTGCTGG + Intergenic
1130650609 15:85760212-85760234 TTGGCAGGTGTGTGCCATGGGGG + Exonic
1130696462 15:86136484-86136506 GTGGCAATTGTGGGTAATGGGGG + Intergenic
1131186305 15:90277210-90277232 GTGGCACTTTTGTGACAGGAAGG - Exonic
1131386770 15:92014587-92014609 GTGGGTGTTTTGTGACAAGGAGG - Intronic
1132614576 16:833732-833754 CTGGCAGCTGTGTGACTTGAAGG + Intergenic
1133186824 16:4105972-4105994 GTGGCAGTAGTGTGACCTAGAGG - Intronic
1133267852 16:4595319-4595341 GGGGCAGTGGGGTGACAAGGAGG + Intronic
1137520843 16:49194118-49194140 GTGGCAGTGGTGTTCGATGGGGG + Intergenic
1139429750 16:66904794-66904816 TTGGTAGGTGGGTGACATGGGGG - Intergenic
1142104272 16:88293816-88293838 GTGGGAATTGTGGGGCATGGAGG + Intergenic
1143419329 17:6776497-6776519 TTGGCAGCTGTGTGATATGGTGG + Intronic
1143530904 17:7502843-7502865 GAAACAGCTGTGTGACATGGGGG + Intronic
1143775351 17:9195490-9195512 GTGACAGCTGTGTGACATGGAGG - Intronic
1145899810 17:28483162-28483184 GTGGCAGGTGTGGGACCTGTGGG - Intronic
1147652320 17:42069628-42069650 GTGGCTGTTGGCTGACATGGAGG - Intergenic
1148809849 17:50283526-50283548 GTGGCAAGTGTGGGGCATGGAGG - Intergenic
1150078992 17:62219735-62219757 AGGGCAGTTTTGTGAGATGGAGG - Intergenic
1152514820 17:80817069-80817091 TTGGCAGGTGGGTGACTTGGGGG + Intronic
1153762977 18:8349626-8349648 GTGCCAGTTGTGGGACACAGAGG - Intronic
1154385522 18:13888550-13888572 GTGAAAGGAGTGTGACATGGTGG - Intronic
1155101532 18:22615088-22615110 GAGGCAGCTGTGAGGCATGGGGG + Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156486279 18:37467665-37467687 CTGGCAGCTGTGTGACTTGGGGG - Intronic
1157319240 18:46621533-46621555 GGGGCACTTGTGTGACAGGAAGG - Intronic
1160446395 18:78930655-78930677 TTGAGAGTTTTGTGACATGGGGG - Intergenic
1160598205 18:79992414-79992436 CTGGCAGTGGTGAGACAAGGTGG + Intronic
1163084740 19:14971349-14971371 GTGGAAGGTGAGTGAGATGGAGG - Intronic
1163572586 19:18091100-18091122 ATGGCAGGTGTGTGAGCTGGAGG + Intronic
1163870263 19:19815393-19815415 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1163914840 19:20231981-20232003 GTAGCAGCTGTGTGAAAAGGGGG + Intergenic
1163948346 19:20561428-20561450 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1163969760 19:20780854-20780876 GTGGCAGCTGTGGGAAAAGGGGG - Intronic
1164000287 19:21092204-21092226 GTGGCAGCTGTGGGAAAAGGGGG - Intronic
1164006653 19:21155988-21156010 GTGGCAGCTTTGTGAAAAGGGGG - Intronic
1164017704 19:21267304-21267326 GTGACAGCTGTGAGACAAGGGGG + Intronic
1164022661 19:21322241-21322263 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1164048494 19:21563482-21563504 GTGGCAGCTGTGGGAAAAGGGGG + Intergenic
1164306445 19:24007886-24007908 GTGGCAGCTGTGGGAAAAGGGGG + Intergenic
1167615941 19:50533757-50533779 GTGGAAATTCTGTCACATGGGGG + Intronic
1168007743 19:53504949-53504971 GGGGCTGTTGTGTGAGAGGGAGG + Intergenic
925077794 2:1032971-1032993 GGGGCAGTCATGTCACATGGTGG + Intronic
927176818 2:20415682-20415704 GTGGCTGTTGTGGGAGATGGGGG + Intergenic
927880030 2:26683821-26683843 GAGGCAGTTGGGGGACATGAAGG - Intergenic
929213001 2:39379696-39379718 GTGGCAGTTGTCTTATTTGGAGG - Intronic
931221443 2:60291777-60291799 GTGGAAGTTGTGAGACAGGGTGG - Intergenic
932128539 2:69167193-69167215 GTGGAACCTGTGGGACATGGGGG + Intronic
932895751 2:75637884-75637906 GTGGCATTTCTGTGAGATAGAGG - Intergenic
935892708 2:107696779-107696801 GGGTCTGTTGTGTGTCATGGAGG + Intergenic
936501879 2:113073054-113073076 TTGGTAGCTGTGTGACATGGGGG - Intronic
936944229 2:117916135-117916157 GTGGCAGGAGTGTGACATGTAGG - Exonic
937304917 2:120865305-120865327 GTGGCAACTGTGTTACATGGGGG - Intronic
938767304 2:134468856-134468878 GTGGCAGTCGTGTGCCAGGCAGG + Intronic
940271163 2:151891931-151891953 ATGACAGGTGTGTGACAGGGTGG + Intronic
940325079 2:152416676-152416698 GTGGCACTTCTGTGATTTGGAGG + Intronic
941402204 2:165044875-165044897 GTGGCAGCTGTGGGGGATGGGGG + Intergenic
942216228 2:173721527-173721549 ATGACAGTAGTTTGACATGGAGG - Intergenic
946036453 2:216746264-216746286 GTGGCTGCTATGGGACATGGGGG - Intergenic
946909269 2:224443764-224443786 GTGGCAGGAGTCTGGCATGGTGG - Intergenic
947253544 2:228135765-228135787 GAGGAAGTTGAGTCACATGGTGG + Intronic
947541325 2:230981830-230981852 GTGGCATTTGTGTGACAAGCAGG + Intergenic
948127899 2:235578190-235578212 GTGGCAGTTTCATGACATGGGGG - Intronic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
948609716 2:239159175-239159197 GTGGGAGTAGTGTGAATTGGGGG - Intronic
1170320557 20:15093083-15093105 GTGTCATTTATGTGGCATGGTGG - Intronic
1170975871 20:21164064-21164086 GGGGCAGTGGTGTGACATTCAGG - Intronic
1171367921 20:24639015-24639037 GCAGCAGGTGTCTGACATGGGGG + Intronic
1173086752 20:39926967-39926989 GTGGCAGATGTGGGAGAAGGGGG + Intergenic
1174849603 20:53979631-53979653 GTGGCAGTGGTGTGGCTTGGGGG + Intronic
1175266306 20:57705580-57705602 GTGCCTGTTGTGTGCCATGAAGG - Intronic
1176026201 20:62986723-62986745 GTGGCTGGAGTCTGACATGGGGG + Intergenic
1178839380 21:36126627-36126649 GAGGCTGTTGAGTGCCATGGGGG - Intergenic
1179403478 21:41106294-41106316 GTGGCCGGTGTGTCACATGTTGG + Intergenic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1183483318 22:38076466-38076488 TTGGCAGGGGTGGGACATGGAGG + Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184738500 22:46412918-46412940 GTGCCAATTGTGGGGCATGGTGG - Intronic
1185138133 22:49085291-49085313 GTGGCAGTTGGGGGACATTGTGG - Intergenic
951540344 3:23776287-23776309 CTGACAAGTGTGTGACATGGGGG - Intergenic
951611106 3:24494234-24494256 GAGGAAGTTGTGTGACATGGGGG - Intronic
952054076 3:29423099-29423121 GTAGCATGTGTGTTACATGGAGG + Intronic
952314874 3:32223886-32223908 GTGGCTGTTGTTTGATTTGGTGG + Intergenic
952388054 3:32857106-32857128 ATGGCAGTTGGGTGACCTTGAGG - Intronic
953210826 3:40873542-40873564 GTGGCAGTTGCTGGAAATGGAGG - Intergenic
955071630 3:55576781-55576803 GCTGCAGTTTTCTGACATGGTGG - Intronic
955234141 3:57124803-57124825 GTGCCGTGTGTGTGACATGGAGG - Intronic
955495904 3:59532109-59532131 GTGGCATTTGTGTGGCAGTGTGG - Intergenic
956704927 3:71991508-71991530 GGAGCAGGTGTGTCACATGGTGG + Intergenic
959395753 3:105836130-105836152 CTGAGAGTTGTGTAACATGGTGG - Intronic
960996705 3:123345022-123345044 GTGGCAGGGGTCTGACATGCAGG + Intronic
964720914 3:159766168-159766190 GTGGCAGCTGTGTGGCAGGTGGG + Intronic
965874388 3:173299461-173299483 GAGGCTGTTGTGGGAGATGGGGG + Intergenic
966411097 3:179646707-179646729 GGAGCAGTAGAGTGACATGGTGG + Intergenic
976397156 4:84568604-84568626 GTGGGAGTTGTGTGAGACTGTGG - Intergenic
976658681 4:87516585-87516607 ATGGTAGTTCTGTGAAATGGAGG - Intronic
980522180 4:133949097-133949119 TTCACAGTTGTGTGGCATGGGGG + Intergenic
981376902 4:144026454-144026476 GTGTCAGTTGAGTCTCATGGAGG - Intergenic
981387405 4:144147804-144147826 GTGTCAGTTGAGTCTCATGGAGG - Intergenic
981635138 4:146868840-146868862 GTGGAAGGTGTCTGTCATGGGGG + Intronic
982690331 4:158540828-158540850 ATGGCTGTTGTCTGACATTGTGG + Intronic
986187587 5:5459291-5459313 GTGGCAGTTAGGGGAGATGGAGG + Intronic
987584111 5:19832450-19832472 CTGGCATTTCTGTGACAGGGAGG + Intronic
987610050 5:20191449-20191471 TTGGTATTTGTGTGCCATGGTGG + Intronic
988423669 5:31037458-31037480 GAGGCAGTGGGGTGACAGGGTGG + Intergenic
989231074 5:39086751-39086773 GTGGCAGTTGTGGGCCAAGAAGG - Intergenic
989562799 5:42870900-42870922 GTGGCTGTTGTGGGGGATGGGGG + Intronic
990008362 5:50967709-50967731 GTGGCAGTGGTGGGAGGTGGTGG + Intergenic
1001177149 5:169480937-169480959 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1001440704 5:171740574-171740596 GTGGCATTTGTGTAACAGGTAGG + Intergenic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1003287534 6:4747476-4747498 GTGGCAGGAGTGGGACATGAGGG - Intronic
1007182301 6:39938219-39938241 GTGGAAGGTGTGGGTCATGGGGG + Intergenic
1008042286 6:46815263-46815285 GTGGCTGTTGTGGGGAATGGGGG + Intronic
1008379885 6:50829480-50829502 GTGGCATTTGAGTGACATTCAGG - Intronic
1009858073 6:69289845-69289867 GTGCCAATTCTGTGATATGGCGG - Intronic
1011214860 6:84994742-84994764 GTGGAATTAGTGTGGCATGGTGG - Intergenic
1012264968 6:97130695-97130717 GTTGCTGTTTTCTGACATGGAGG + Intronic
1017885973 6:158599738-158599760 GAGGCCGCTGTGTGTCATGGAGG + Intronic
1019141250 6:169945298-169945320 GGGGCAGGTGTGTCACGTGGTGG + Intergenic
1019325293 7:435268-435290 GTGTCTTCTGTGTGACATGGAGG - Intergenic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1019745845 7:2700074-2700096 GTGGCAGTGCTGTGTCCTGGAGG + Intronic
1019948975 7:4355550-4355572 GTAGCAGGTGTCTTACATGGTGG - Intergenic
1020198795 7:6063152-6063174 GTGGGAGGTGTTGGACATGGGGG + Intergenic
1020382718 7:7564762-7564784 GTGGCAGTTTCGTGGCATGGTGG + Intergenic
1024126567 7:46303532-46303554 GTGGCTGGTGTCTGAAATGGGGG - Intergenic
1025775629 7:64558381-64558403 GTGGCAGCTGTGGGAAAAGGGGG + Intronic
1025823075 7:64989246-64989268 GTTGCAGGTGTGTGGCATTGTGG - Intronic
1025824778 7:65001544-65001566 GTGGCAGTGGTGGGAAAAGGAGG + Intronic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1029900589 7:104035116-104035138 CTGACAGCTGTGTGACATTGGGG + Intergenic
1031048620 7:116922114-116922136 TTGACAGTTGTGTGACATTTGGG + Intergenic
1033304641 7:140215429-140215451 GGGGCAGGTTTGTGGCATGGGGG + Intergenic
1034502595 7:151460491-151460513 GTGGCAGATGTGGGACCCGGGGG + Intergenic
1034683200 7:152946998-152947020 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1035954762 8:4064572-4064594 ACGGCAGTTGTATGACAGGGTGG - Intronic
1041734869 8:61099233-61099255 GGGGCAGTGGTGTGATCTGGTGG + Intronic
1043033689 8:75170168-75170190 GTGGGAGCTGTCTTACATGGTGG + Intergenic
1043556762 8:81439267-81439289 GTGGCTGCTGTGGGGCATGGGGG + Intergenic
1045531502 8:102989422-102989444 GTGGTAGGGGTGTGAGATGGGGG - Intergenic
1049100174 8:140573715-140573737 GTGACATTTGTGTTCCATGGAGG + Intronic
1049405571 8:142450521-142450543 GTGGCTGTTGGGGGCCATGGGGG - Intronic
1049993195 9:1009508-1009530 GTGGCATGTGGGTGACATGCTGG + Intergenic
1050438415 9:5633691-5633713 GAGGGAGCTGTGTGAGATGGTGG - Intronic
1052894586 9:33735224-33735246 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1052894592 9:33735254-33735276 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1053548711 9:39052142-39052164 GGGGAAATTGTGTGTCATGGGGG - Intergenic
1053812828 9:41872201-41872223 GGGGAAATTGTGTGTCATGGGGG - Intergenic
1054617767 9:67315238-67315260 GGGGAAATTGTGTGTCATGGGGG + Intergenic
1057689768 9:97273394-97273416 ATGGAAGTTGTGTGTCATGGGGG + Intergenic
1057899283 9:98935506-98935528 GTGGCTGATGTGTGATAGGGAGG + Intergenic
1059329586 9:113526430-113526452 GGGGTAGAAGTGTGACATGGTGG + Intronic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1059995697 9:119906351-119906373 ATAGCAGTAGTGTGACATGAAGG + Intergenic
1187962404 X:24579263-24579285 GTGGTGGTGGTGTGGCATGGTGG + Intronic
1191223255 X:58014231-58014253 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1192257063 X:69470533-69470555 GTGCCTGTTGTGGGACATGAAGG - Intergenic
1193276103 X:79590037-79590059 GTGGCAGTGGTGGCACAGGGTGG + Intergenic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1194231575 X:91331399-91331421 GTGGCTGCTGTGTGAGATTGGGG - Intergenic
1194505027 X:94723831-94723853 GTGGCTGCTGTGGGACATGAGGG + Intergenic
1194774111 X:97942164-97942186 ATGGCAGGAGTGTAACATGGGGG + Intergenic
1197132399 X:123020133-123020155 GTGGCTGTTGTGAGGGATGGGGG - Intergenic
1201254282 Y:12091708-12091730 GGAGCAGTTGTCTCACATGGTGG - Intergenic
1201306696 Y:12556637-12556659 GTGGCTGCTGTGGGAGATGGGGG - Intergenic