ID: 1028440195

View in Genome Browser
Species Human (GRCh38)
Location 7:90850764-90850786
Sequence CCTGTTAAGCAGCTGTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028440189_1028440195 16 Left 1028440189 7:90850725-90850747 CCTCTCCATCAGGAGCCTGTTGT 0: 1
1: 0
2: 2
3: 14
4: 152
Right 1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG No data
1028440191_1028440195 11 Left 1028440191 7:90850730-90850752 CCATCAGGAGCCTGTTGTGCGGG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG No data
1028440193_1028440195 1 Left 1028440193 7:90850740-90850762 CCTGTTGTGCGGGCTCTTCTAAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028440195 Original CRISPR CCTGTTAAGCAGCTGTTGAG AGG Intronic
No off target data available for this crispr