ID: 1028442440

View in Genome Browser
Species Human (GRCh38)
Location 7:90879880-90879902
Sequence GTCTCCCTTCTCTGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028442440_1028442447 3 Left 1028442440 7:90879880-90879902 CCCACTCCCCAGAGAAGGGAGAC 0: 1
1: 1
2: 1
3: 29
4: 294
Right 1028442447 7:90879906-90879928 GAGTGGTGTGATACCCAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 115
1028442440_1028442448 4 Left 1028442440 7:90879880-90879902 CCCACTCCCCAGAGAAGGGAGAC 0: 1
1: 1
2: 1
3: 29
4: 294
Right 1028442448 7:90879907-90879929 AGTGGTGTGATACCCAGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 126
1028442440_1028442446 2 Left 1028442440 7:90879880-90879902 CCCACTCCCCAGAGAAGGGAGAC 0: 1
1: 1
2: 1
3: 29
4: 294
Right 1028442446 7:90879905-90879927 TGAGTGGTGTGATACCCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028442440 Original CRISPR GTCTCCCTTCTCTGGGGAGT GGG (reversed) Intronic
900329152 1:2125530-2125552 GCCTCCCTCCTCAGGGGAGCAGG - Intronic
900524840 1:3123551-3123573 GGCCCCCCTCACTGGGGAGTGGG - Intronic
901334443 1:8437148-8437170 GTTTCCCTTGTTTGGGAAGTGGG - Intronic
902282391 1:15384104-15384126 GGCACCCTTCTCTGGGGGTTTGG - Intronic
902834853 1:19040434-19040456 GTGTCACTTTTGTGGGGAGTTGG + Intergenic
903326637 1:22572680-22572702 ATATCCCTTCTCTGGGGCTTGGG - Intronic
904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG + Intronic
904303100 1:29568807-29568829 GTCTCCCTGGTCTGGTGGGTGGG + Intergenic
905091798 1:35436101-35436123 TTCTCCCTTCTCCGGGGAGAAGG + Intronic
905154758 1:35966940-35966962 GTTTCCCTTCTTTAGGGAGGTGG + Exonic
906094747 1:43215040-43215062 GTCTACATTCTCTGTGGATTTGG - Intronic
906271435 1:44482324-44482346 GGCTCCCTTCTCAGGGGAGCAGG + Intronic
907271878 1:53296067-53296089 GTGTCCCTGCTCTGAGGATTGGG - Intronic
907761699 1:57367889-57367911 TTCTGCCTGCTCTGAGGAGTGGG - Intronic
907880740 1:58546946-58546968 TTCTCCCGTCTTTGGTGAGTTGG + Intergenic
911242696 1:95483086-95483108 GCCTCCCTTGGCTGGGGGGTAGG - Intergenic
911266397 1:95749810-95749832 GGCTCCCTTCTCTGGGCTGGGGG - Intergenic
912995087 1:114525053-114525075 CTCCCCCTTCTCTGGGGTCTTGG - Intergenic
913230998 1:116740790-116740812 TTCTTCCTTCACTGGGGACTTGG + Intergenic
913231043 1:116741013-116741035 TTCCTCCTTCTCTGGGGACTTGG + Intergenic
913231053 1:116741055-116741077 CTCTTCCTTCACTGGGGACTTGG + Intergenic
913231058 1:116741076-116741098 GGCTTCCTTCTCTGGGGATGTGG + Intergenic
915456546 1:156044311-156044333 CTCTCCCTTTTCTGGGGAAGGGG - Intronic
915545724 1:156596380-156596402 GTCTCACATCTTTGGGGACTTGG + Exonic
915723882 1:158003705-158003727 GTCTCCCTTCACCAGGCAGTGGG + Intronic
920761884 1:208791860-208791882 GTATCCTTTCTGAGGGGAGTTGG + Intergenic
922917245 1:229268999-229269021 GTCTCCCTTCTCTTTGGGGGAGG - Intergenic
923465709 1:234246393-234246415 GTCTCCTTTCTCTGAGAAGCAGG + Intronic
924334474 1:242973481-242973503 GTCTCCCTGCGCTGGGGTTTGGG - Intergenic
924772291 1:247088538-247088560 GTCTGCCTCCCCTGGGGAGGAGG + Intergenic
1064511161 10:16093766-16093788 GTCTCCCTCCTCTGTGTAGCAGG - Intergenic
1064742570 10:18448698-18448720 TTTTCCCTTCTCTGGGGTGGAGG - Intronic
1065901935 10:30215783-30215805 TTTTCCCTCCTCTAGGGAGTCGG + Intergenic
1066080554 10:31927875-31927897 GCCTCCCATCTCAGGGGAGCTGG - Intronic
1067796923 10:49327504-49327526 GTCTTCCTTCTGTGGGCAGTAGG + Intergenic
1067859887 10:49835028-49835050 TTCTCCCTTCTCTAGGAAGAAGG + Intronic
1068658277 10:59596466-59596488 TCCTGCCTTCTCTGGGGAGTAGG + Intergenic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1069512986 10:69056165-69056187 CTCTGCCTTCTCTGGGGACAAGG - Intergenic
1071783911 10:88878574-88878596 GTCTCCATTATCTGTGAAGTGGG - Intergenic
1072686575 10:97540999-97541021 GTCTTGCTGCCCTGGGGAGTTGG + Intronic
1073835084 10:107432032-107432054 GTCCCCAGTCTTTGGGGAGTAGG - Intergenic
1074025398 10:109628452-109628474 TTCTCCCTACACTGGGGAGTGGG - Intergenic
1075918336 10:126189067-126189089 GTCTCCCTACTCTAGGATGTGGG - Intronic
1076185042 10:128440297-128440319 GCCTCCCTTAGCTGGGGGGTGGG - Intergenic
1077158285 11:1101209-1101231 GTCTCCCTTCGCAGGTGAGGAGG + Intergenic
1077862515 11:6195730-6195752 GACACCCTGCTCTGGGGAGCAGG + Intergenic
1077939482 11:6825329-6825351 GTCTCCCTGAGCTGGGGACTGGG + Intergenic
1078850072 11:15155678-15155700 GTCTACCTTCTGTGTGAAGTGGG - Intronic
1078887919 11:15523853-15523875 GTAACCCTTCTCTGGGATGTTGG + Intergenic
1079124452 11:17708853-17708875 GCCTCCCTTCTCTGGGCAGGAGG - Intergenic
1079181344 11:18196421-18196443 GTCTCCCTTCTCTGTAAAATGGG + Intronic
1081004415 11:37717116-37717138 GTCTTCCTTTTTTGGGGAGATGG - Intergenic
1081652628 11:44834573-44834595 TTCTCACTTCTCTAGGGAGTTGG + Intronic
1081771271 11:45651797-45651819 GTCCCCCTTCTGTGGGCAGAGGG - Intronic
1082068867 11:47922539-47922561 CTCTCCCTTCTCTCTGCAGTGGG + Intergenic
1082785441 11:57313836-57313858 GCCTCCATTCTCTGAGGAGGGGG + Exonic
1084045826 11:66567360-66567382 TTCTCCCTTCCCTCTGGAGTGGG - Intronic
1084693305 11:70739328-70739350 TCCTCCCTTCTGTGGGGAGGTGG - Intronic
1084856938 11:71995506-71995528 GTCTACCTTCTCTTTGCAGTAGG - Exonic
1085412438 11:76299262-76299284 GTCCCCCTTCCCTGAGGAGCTGG + Intergenic
1085676569 11:78525682-78525704 GTCTCCCCTCACTGGGGATGGGG - Intronic
1085942618 11:81222909-81222931 GCCTCCCTTGGCTGGGGGGTGGG + Intergenic
1087600552 11:100309767-100309789 GTTTCCCTTCTCTATGGAGGAGG + Intronic
1088048576 11:105482541-105482563 GGCTCTCTTCTCAGTGGAGTGGG - Intergenic
1089287269 11:117415669-117415691 GTCTACCTTGGGTGGGGAGTTGG + Intergenic
1089615080 11:119690686-119690708 GTCTCCCCTCTGTGGGGTTTGGG - Intronic
1091638260 12:2214659-2214681 TTCTCCCTGCTCCGGGGAGGTGG + Intronic
1092284198 12:7119403-7119425 GGCACCCTTCTCTGGGGATGGGG + Intergenic
1092651698 12:10641819-10641841 GTTTCCCCTCCCTAGGGAGTGGG + Intronic
1093383444 12:18521969-18521991 GCCTCCCTTGGCTGGGGGGTGGG + Intronic
1093493157 12:19726753-19726775 TTCTGCCTGCTCTGTGGAGTGGG + Intergenic
1095782991 12:46080897-46080919 GTATCCCTTCTTTGGCTAGTGGG + Intergenic
1097106641 12:56629944-56629966 GTCTCCTTGCTCTGGGGTCTGGG - Intronic
1101066454 12:101027142-101027164 GCCTCCCTTGGCTGGGGAGTGGG - Intronic
1106144308 13:27037924-27037946 CTCTCCCTTCTCTTCGGAGATGG - Intergenic
1106498889 13:30307891-30307913 TTCTCCATTCTCTGGGGAGGGGG + Intergenic
1107435822 13:40380051-40380073 GGCTCACTTCCCAGGGGAGTCGG - Intergenic
1109136717 13:58660868-58660890 ATTTCTCTTCTTTGGGGAGTAGG + Intergenic
1110148250 13:72220775-72220797 TTCTCCGGTCTCTGGGCAGTGGG + Intergenic
1110823154 13:79939959-79939981 TTTTCCCTTTTGTGGGGAGTTGG - Intergenic
1111092112 13:83461735-83461757 GCCTCCCTTGCCTGGGGAGAGGG - Intergenic
1113696446 13:112349421-112349443 GTCTTCCTTCTCAGGTGAGTGGG + Intergenic
1116535010 14:46017219-46017241 GTCCCGCTTCTCTGGGGAAGGGG - Intergenic
1117847364 14:59925365-59925387 GTCTGCCTCCTCTGGAGAGAAGG + Intronic
1118681710 14:68248618-68248640 TTCTCACTACTCTGGGGAGTGGG + Intronic
1118813554 14:69292631-69292653 TTCTCTGTTCTCTGGGGAGATGG + Intronic
1119193866 14:72702664-72702686 TTCTCCCTGCTCGGGGGAATTGG - Intronic
1120909082 14:89649222-89649244 GTCTGCCCTTTCTGGGGATTTGG + Intergenic
1121077806 14:91083995-91084017 GTCTTCCTCCTTTGGGAAGTAGG + Intronic
1121842479 14:97145750-97145772 GACTCCCTTCTGCTGGGAGTTGG + Intergenic
1122117388 14:99534736-99534758 GTCTCACCTGTCTGTGGAGTGGG - Intronic
1124383685 15:29188795-29188817 CTGTCCCTTCTCTGGAGAATGGG - Intronic
1125044470 15:35230401-35230423 GACTCACCTCTCAGGGGAGTGGG + Intronic
1126701647 15:51373165-51373187 GCTTCCTTTCTCTGGGGAGCAGG + Intronic
1127013616 15:54658012-54658034 GTCTCCCTTGTTTGGGTATTAGG + Intergenic
1127393477 15:58525546-58525568 CTCTGCCTTGTTTGGGGAGTGGG - Intronic
1127876257 15:63114153-63114175 GTCTCCCTTCGCTTGGCAGCAGG - Intergenic
1130928204 15:88400768-88400790 GTCACCCTTCCCAGGGGACTGGG - Intergenic
1130947710 15:88561331-88561353 GTCTCGCTTTTCTGGGGAAGGGG - Intergenic
1131364959 15:91831094-91831116 CTCTCCCCTTTCTGGGGATTGGG - Intergenic
1131506641 15:93025516-93025538 GTCTTACTTGACTGGGGAGTAGG + Exonic
1131977690 15:97961699-97961721 GTTTCCCTCTTCTGGGGAGCAGG + Intronic
1132340179 15:101073397-101073419 GTCCCGCTTTTCTGGGGAATGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133050082 16:3112622-3112644 GACTCCCTTCCCGGGGGAGGGGG + Exonic
1134205960 16:12238067-12238089 ATCTCCCTTCTCTGGCTTGTAGG - Intronic
1135591996 16:23711680-23711702 GTCTCCCTCCTCTGTAGAATGGG - Intronic
1135592845 16:23717069-23717091 GTCTCCCTTCCTTGGGGACCTGG - Intergenic
1136497920 16:30655120-30655142 GTCTTCCCTCTCGGAGGAGTGGG + Exonic
1139179684 16:64732056-64732078 GTCCCACTTTTCTGTGGAGTGGG - Intergenic
1139510314 16:67424500-67424522 CTCTCCCTTGCCTGGGGACTGGG + Intergenic
1140084203 16:71779334-71779356 GACTCTCTTTTTTGGGGAGTAGG + Intronic
1140407657 16:74721738-74721760 GCCTCTCTTCTCTGTGAAGTAGG - Intronic
1140509333 16:75495662-75495684 GCCCCCCTTCTCTGGGGATTTGG - Intergenic
1140696041 16:77535351-77535373 GTCTCCCCTTTCTTGGGACTTGG - Intergenic
1142420988 16:89969876-89969898 GCCTCCCTGCTCTGTGGTGTTGG - Exonic
1142748150 17:1970908-1970930 GGCTCGCTTCTCTAGGGAGAGGG - Intronic
1143165121 17:4893700-4893722 GGCTCCCTTCTCTAGAGAGTGGG + Intronic
1143322553 17:6077542-6077564 GTTTCCCTGGTCTGGGGAGGTGG - Intronic
1144681235 17:17196433-17196455 GTTTCCCTTCTTTGGGTAATAGG - Intronic
1145012225 17:19375888-19375910 TTTTCCTTTCTCTTGGGAGTGGG - Intronic
1145810106 17:27759398-27759420 GGCTCCCTTTTCTGGGGTGTAGG - Intronic
1146513256 17:33469012-33469034 GCCTCCCTTCTCTGGGGCCCAGG - Intronic
1146604420 17:34246168-34246190 CTCTGCCTTCACTGGGGAGGAGG + Intergenic
1148093323 17:45035608-45035630 GTCTCCTTCCTCTAGGAAGTTGG - Intronic
1148530028 17:48381060-48381082 GTCTTCCTTCTCTGGGTACAGGG + Intronic
1149610359 17:57954879-57954901 GTCTCCCTTCCCTGCGGCGCTGG + Intronic
1150256742 17:63752313-63752335 GTCTTACTTCTCTGTTGAGTCGG + Exonic
1150417119 17:64996674-64996696 GTTTTCCTCCTCTGGGAAGTGGG - Intergenic
1150483884 17:65531016-65531038 GTCTCCCTTGGCTGGGGACAGGG - Intronic
1150602984 17:66666602-66666624 TTCTCCCTTCCTTGGGTAGTAGG - Intronic
1150794545 17:68227248-68227270 GTTTTCCTCCTCTGGGAAGTGGG + Intergenic
1151250777 17:72832909-72832931 GTCTCCCTCCTCTGTTGAGGTGG - Intronic
1151565014 17:74893032-74893054 GTCTCCCTTCCCGGGGGTGGGGG + Intronic
1152638836 17:81441156-81441178 ATCTCCCATCTCTGAGGTGTGGG + Intronic
1156269056 18:35514341-35514363 ATCTCCCTTTGATGGGGAGTTGG + Intergenic
1157218162 18:45802585-45802607 TCCTCCCTTCTCTGGGCACTGGG - Intergenic
1157274679 18:46302277-46302299 TTCTCCACTCTCTGTGGAGTGGG + Intergenic
1158105729 18:53882992-53883014 GTCTCCCTTGGCTGGGGGGTGGG + Intergenic
1158415463 18:57246330-57246352 GTCAGCCTTCTCAGGGGAGAGGG - Intergenic
1162098447 19:8324820-8324842 GTCTGCCCCGTCTGGGGAGTGGG + Exonic
1163541311 19:17912468-17912490 CTCCCTCTTCTCTGGGCAGTGGG + Intergenic
1163872028 19:19830160-19830182 GCCTCCCTTGGCTGGGGGGTGGG - Intergenic
1164163948 19:22651130-22651152 GCCTCCCTTGGCTGGGGGGTGGG + Intronic
1164845519 19:31429393-31429415 GTCTTCCTTATCTTGGGAGAGGG - Intergenic
1165131570 19:33635563-33635585 GCCTCCCTCCTCTGTGGAGGAGG - Intronic
1165392561 19:35546829-35546851 GTGTCCCTTCTCAGGGGTCTGGG - Intronic
1166586120 19:43951038-43951060 GATTCCCTTCTCCGGGGACTTGG + Intergenic
1167767257 19:51491743-51491765 CTCTCCTTCCTCTGGGGAGGGGG + Exonic
1167941364 19:52948087-52948109 GTCACCCCTATCTGGAGAGTTGG - Intronic
1167943493 19:52966525-52966547 GTCACCATTATCTGGAGAGTTGG - Intergenic
1168706790 19:58474939-58474961 GTCTCCCGTCTCTGGGCTGCTGG - Intronic
925233104 2:2253265-2253287 GCCTCCCTTCTCTGGGAACAGGG + Intronic
925987551 2:9228945-9228967 ATCTTCCACCTCTGGGGAGTTGG - Intronic
928210751 2:29321936-29321958 CTCTTCCTTCTGTGGGCAGTTGG - Intronic
931997323 2:67851702-67851724 GCCTCCCGTCTCTGAGAAGTAGG - Intergenic
932560464 2:72863143-72863165 GTCTCCCTTGGCTGGGCAGGGGG - Intergenic
932575409 2:72959912-72959934 GGATCCCTTCTCTGGGGACAGGG + Intronic
934919861 2:98334174-98334196 ATCTACCTTCCCTGGGGAGGAGG - Intronic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
935667430 2:105525101-105525123 GGCTGCATGCTCTGGGGAGTTGG + Intergenic
935671566 2:105561076-105561098 TTCTCTTTTCTATGGGGAGTGGG - Intergenic
936346293 2:111677747-111677769 GTCTGCCTTCCCTGGGGGTTTGG + Intergenic
937110728 2:119365544-119365566 GTCTACCTTCCCTGGGGAGGGGG + Intronic
945306837 2:208266611-208266633 GGCTGCCTTGTCTGGCGAGTGGG + Intronic
948371067 2:237489274-237489296 CTCCCAGTTCTCTGGGGAGTTGG - Intronic
1168914223 20:1473137-1473159 GTCTGTCTTCTCTCGGGAGGAGG + Intronic
1168933610 20:1644777-1644799 GCCTCCCTTGGCTGGGGGGTGGG + Intronic
1169033374 20:2430641-2430663 CTCCCCCAGCTCTGGGGAGTGGG - Intronic
1169683576 20:8244785-8244807 CTCTCTCTTCTCTGTGGAATTGG - Intronic
1172294484 20:33798864-33798886 GTCTCACCTCCCAGGGGAGTGGG - Intergenic
1172755850 20:37283825-37283847 GCCTCTCTTCTCCGGGCAGTGGG - Intergenic
1173322103 20:41997688-41997710 TTCTTCCTTCACTGGGGACTTGG + Intergenic
1173322110 20:41997730-41997752 TTCTTCCTTCACTGGGGACTTGG + Intergenic
1173434829 20:43023221-43023243 ATCTACCTTGTTTGGGGAGTGGG - Intronic
1174105879 20:48161812-48161834 GTGTCCTTGCTGTGGGGAGTCGG - Intergenic
1175371821 20:58497327-58497349 GTCTCCCTGCCATGGGGAGAGGG + Intronic
1175451842 20:59076033-59076055 GCCTCCCTTCTTTGGGGAAGGGG - Intergenic
1175850215 20:62086601-62086623 CTCTCCCTTCTCAGATGAGTGGG - Intergenic
1175944852 20:62553899-62553921 GCCTCCCTGCTCTGGGGTGAGGG + Intronic
1176185436 20:63775823-63775845 GTCGTCCTTCTCTGGGGTGAGGG + Exonic
1176261363 20:64182553-64182575 CTCTAACTGCTCTGGGGAGTGGG + Intronic
1177525903 21:22289247-22289269 ATCTATTTTCTCTGGGGAGTGGG + Intergenic
1179641154 21:42747846-42747868 ATCCCCCTTCTCTGGGGCTTAGG - Intronic
1181168074 22:20993864-20993886 GTCTCTGTTCTCTGGGGCGAGGG + Intronic
1182322760 22:29489229-29489251 TTCCTCCTTCTCTGGGGACTTGG - Exonic
1182322781 22:29489331-29489353 TTCCTCCTTCTCTGGGGACTTGG - Exonic
1182322805 22:29489451-29489473 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182322813 22:29489493-29489515 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182322833 22:29489595-29489617 CTCTTCCTTCTCTGGGGACTTGG - Exonic
1182322844 22:29489637-29489659 TTCTGCCTTCACTGGGGACTTGG - Exonic
1182322853 22:29489679-29489701 TTCTGCCTTCACTGGGGACTTGG - Exonic
1182322862 22:29489721-29489743 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182322871 22:29489763-29489785 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182322880 22:29489805-29489827 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182322890 22:29489847-29489869 TTCTTCCTTCACTGGGGACTTGG - Exonic
1182416776 22:30226399-30226421 GTCTTCCTCCTCTGAGGAGCAGG - Intergenic
1182732046 22:32503631-32503653 GTCTCGCTTTTCTGGGGAAGGGG + Intergenic
1183016623 22:34993680-34993702 GTCTTCATTCTCTGGGCAGCAGG - Intergenic
1183569340 22:38640500-38640522 GTCTTCCTTTTCAGGGGCGTAGG - Intronic
949695379 3:6688525-6688547 GTCTCCTTTCTCTGTGGGTTGGG - Intergenic
950294024 3:11812572-11812594 GCATCCCTTCTCTGGGAACTGGG - Intronic
950423577 3:12912761-12912783 CTCTCCCTTCTCTCTGCAGTGGG + Intronic
950722027 3:14890255-14890277 GTCTCCCTTCTCTGGTTTGCTGG + Intronic
951137162 3:19117865-19117887 TCCTCCCTTGGCTGGGGAGTAGG - Intergenic
953167692 3:40479950-40479972 GACTCCCTTCTATAGGAAGTGGG - Intronic
953931069 3:47005930-47005952 GCCTCCCTACTCTCAGGAGTCGG + Exonic
954423806 3:50432746-50432768 GTCCACCTTCTCTGGGAAGCTGG + Intronic
954704776 3:52473605-52473627 GCCTCCCATCTCTGAGGATTTGG + Intronic
957624347 3:82640434-82640456 TTCTGCCTGCTCTGTGGAGTAGG - Intergenic
957630160 3:82707609-82707631 GCCTCCCTTGGCTGAGGAGTGGG + Intergenic
958787937 3:98618790-98618812 ATTTCCCTTCTCTAGGGAGATGG + Intergenic
959227372 3:103603086-103603108 TTGCCCCTTCTCTGGGGAGCAGG - Intergenic
961740333 3:129029381-129029403 ATCTCCCTTCTCTGGGCTTTGGG - Intronic
963531305 3:146476306-146476328 GCCTCCCTTGGCTGGGGAATGGG - Intronic
963806527 3:149728482-149728504 GTTGCCCTTCTCTGGGGGATAGG + Intronic
964657102 3:159079315-159079337 ATCTTCTTGCTCTGGGGAGTTGG + Intronic
967369524 3:188728728-188728750 ATCTCCCTTCTCTAGTGAGTTGG + Intronic
967410327 3:189160606-189160628 GTCTCCCTGGGTTGGGGAGTTGG - Intronic
968724691 4:2241042-2241064 TTTTCCCTTCTCTGTGGACTTGG - Exonic
969408420 4:7011204-7011226 GTCTCCTTTCTCCCGGGTGTGGG - Intronic
969464482 4:7347635-7347657 GCCTCACCTCTCTGGGGAGAAGG - Intronic
971729596 4:30360827-30360849 GTGTTCCGTCTCTGGGGTGTTGG + Intergenic
972203808 4:36747596-36747618 GCCTGCCTGCTCTGTGGAGTGGG - Intergenic
973229495 4:47825280-47825302 GCCTCACTTCTATGGGGAGGGGG - Intronic
973263594 4:48187945-48187967 TCCTCCCCTTTCTGGGGAGTTGG + Intronic
975689280 4:76949140-76949162 GTCTCCCTTCTCAAGGGAAGCGG + Intergenic
976857740 4:89625142-89625164 GTCTGGGTTCTCTGGAGAGTTGG - Intergenic
978091867 4:104727089-104727111 TTCTGCCTTCTTTGGTGAGTAGG + Intergenic
979822181 4:125188860-125188882 GTCTCTTTTCTCTGGGGTGGAGG - Intergenic
980809441 4:137855892-137855914 GTCTCCTTTCTTTGGGGATAGGG - Intergenic
981920916 4:150083844-150083866 TTCCCACTTCTCTGGGCAGTTGG + Intronic
982497365 4:156108426-156108448 GTCTCGCTTTTCTGGGGAAGGGG - Intergenic
983403061 4:167289650-167289672 GCCTCCCTTGACTGGGGGGTGGG + Intergenic
983471690 4:168164183-168164205 TTTTCCTTTCTCTAGGGAGTAGG + Exonic
985039049 4:185870402-185870424 GCCTCCTTTGTCTGGGTAGTTGG - Intronic
985660057 5:1152528-1152550 GTCTCCCTTCTCTAGGGGATGGG - Intergenic
985802287 5:2012586-2012608 TTTCCCCTTCTCTGGGGAGATGG + Intergenic
985802490 5:2013849-2013871 GTCTCCCGTCCCTGTGGAGTGGG - Intergenic
987211580 5:15689024-15689046 GTCTCACAACTCTGGGGAGATGG - Intronic
988064816 5:26219786-26219808 GTCTCCTGTCTCTGAGGAGAAGG + Intergenic
988260730 5:28883203-28883225 CTTCCCCTTCTCTTGGGAGTAGG - Intergenic
992257085 5:74931894-74931916 GTCACCATTATCTGGAGAGTTGG + Intergenic
993280514 5:85920088-85920110 TTCTCCCTTCTCTGTGGATCAGG - Intergenic
995409303 5:111836639-111836661 CTCTCCCTTCTCTGGGGCTCTGG - Intronic
995881655 5:116850513-116850535 GTCTTCCTGCTCTGAGGAGCGGG + Intergenic
996527324 5:124492592-124492614 GCCTCCCTTGACTGGGGAGTGGG + Intergenic
996750536 5:126884102-126884124 TTCTCGCTTATCTGGGGAGCTGG + Intronic
998133306 5:139661852-139661874 CTCTGCCCTCTCTGGGGAGGAGG + Intronic
998192251 5:140036209-140036231 GCCTTCCTTCTCTGGCTAGTTGG - Intronic
999399403 5:151252967-151252989 GCCTTCCCTCTCTGGGGCGTAGG - Exonic
1000137709 5:158368821-158368843 TAAACCCTTCTCTGGGGAGTGGG + Intergenic
1001459887 5:171902427-171902449 GGTTCCCTTCTCTGGGAAATGGG - Intronic
1001961349 5:175882054-175882076 CTGTCCCTTCTTTGGGGAGCAGG + Exonic
1003380720 6:5622183-5622205 GGCTTCCTGCTCTGGCGAGTAGG - Intronic
1004169226 6:13283230-13283252 GTCTCCTGACTCTTGGGAGTGGG - Intronic
1004797020 6:19097917-19097939 GTCTGCCTACTCTGGAGTGTAGG + Intergenic
1005777405 6:29150344-29150366 GTCTGCCTTCTTTGTGGTGTAGG + Intergenic
1006275346 6:33000911-33000933 GTCTCCATTCGCTGCTGAGTAGG + Intergenic
1006979534 6:38135886-38135908 GGCTCCCTTCTCTGTGGAGCAGG + Intronic
1007357413 6:41331778-41331800 GTCTCCCCTGTTTGGGGCGTTGG + Intergenic
1007606644 6:43122456-43122478 GTCTCCCTACACTGGGAAGCTGG + Intronic
1010087786 6:71940776-71940798 AACTCCCTTCTCTGTGGAATGGG - Intronic
1010746241 6:79565204-79565226 ATCTCCATTCTCTTGGGATTTGG + Intergenic
1013077741 6:106786204-106786226 GTCTCCAGTATCTGGGGACTTGG - Intergenic
1013916092 6:115338742-115338764 TTCTCACCTCTCTGGGGTGTAGG + Intergenic
1015136937 6:129882885-129882907 GCCTCCCTTGGCTGGGGTGTGGG + Intergenic
1015671035 6:135689751-135689773 GCATCTGTTCTCTGGGGAGTGGG + Intergenic
1015699925 6:136024570-136024592 TGCTCCCTTCTCTGTGGAGCTGG - Intronic
1017584284 6:155903159-155903181 GTCTGTCTTCTCAGGGGAGTGGG + Intergenic
1018174759 6:161168893-161168915 GTCCCCCTTCTCTGTAAAGTAGG + Intronic
1018389635 6:163332270-163332292 CTCTCCCTGCCCTGGGGAGCAGG - Intergenic
1018862655 6:167722433-167722455 GTCTCCATTCTCTGTGAAATGGG - Intergenic
1020637292 7:10712527-10712549 CTCTCCCGACTCTGGAGAGTTGG + Intergenic
1022702134 7:32771572-32771594 CTTCCCCTTCTCTTGGGAGTAGG - Intergenic
1022906371 7:34861713-34861735 CTTCCCCTTCTCTTGGGAGTAGG - Intronic
1024018513 7:45342664-45342686 GGCTCTCTTTTGTGGGGAGTGGG - Intergenic
1024740741 7:52351664-52351686 GTCTCTCTTGTCTGGGAATTAGG - Intergenic
1027219057 7:76202383-76202405 TCCTCCCTTCCCTGGGGAGCAGG - Intronic
1028442440 7:90879880-90879902 GTCTCCCTTCTCTGGGGAGTGGG - Intronic
1028594947 7:92538426-92538448 GTCTCCCATCTCTGAAGAGGAGG - Intergenic
1029041377 7:97580016-97580038 GCCTCCCTTGGCTGGGGTGTGGG - Intergenic
1029196656 7:98810264-98810286 GACCCCCCTCTCTGGGGGGTGGG - Intergenic
1029409691 7:100400967-100400989 TTCTCCCTTCTCTGGGGCGCAGG - Exonic
1032599488 7:133278412-133278434 GTCTCCCCTCCCTGGTGAGTGGG - Intronic
1034563813 7:151898041-151898063 TTCTCCCCTCTCTGGGCATTTGG - Intergenic
1034622063 7:152464018-152464040 GTCTCCCTCCTCTCGGGGGGAGG - Intergenic
1035313788 7:157985785-157985807 GTCTCCCTGCTCTCCGGATTTGG - Intronic
1035659083 8:1333337-1333359 GTCTCCCTTCCCTGGGGAGGAGG + Intergenic
1036702537 8:11022634-11022656 GTCACCCTTCTGTGGGTCGTAGG - Intronic
1040572064 8:48620068-48620090 ATCTCTGTTCTCTTGGGAGTGGG - Intergenic
1044356224 8:91225391-91225413 GCCTCCCTTCTCTGGTGGGAGGG + Intronic
1045494993 8:102700642-102700664 CTCTCCTTTCTCTGTGAAGTAGG + Intergenic
1047744855 8:127837153-127837175 ATGGCCCTTCTCTGGGGACTAGG - Intergenic
1047829755 8:128616698-128616720 GTCTCGCTTTTCTGGGGAAGGGG - Intergenic
1048534057 8:135276054-135276076 GTCTCCCCTTGCTGGGGAGAAGG + Intergenic
1050441533 9:5669192-5669214 ATCTCCCCTCTCTTGGGAGTAGG - Intronic
1050630013 9:7549175-7549197 GCCTCCCTTGGCTGGGGAGTGGG - Intergenic
1050660657 9:7879802-7879824 GCCTCCCTTGGCTGGGGGGTGGG - Intronic
1051677079 9:19569447-19569469 TTCACCCTCCTCTTGGGAGTGGG - Intronic
1055090705 9:72363461-72363483 GTCTCCATTCCCAGGTGAGTGGG - Intronic
1056095433 9:83248449-83248471 GGCTGCCTTCACTGGGGAGCTGG + Exonic
1059391302 9:114001241-114001263 GTCTCCCTGCTCCTGGGAGAAGG + Intronic
1059421964 9:114197698-114197720 CTCTCCCTGCTCAGGTGAGTTGG - Intronic
1059565405 9:115379552-115379574 GCCTCCCTGCTCTAGGGAGCAGG + Intronic
1059853932 9:118374163-118374185 GTCTCCCTTCCCTGGGGCCTGGG - Intergenic
1060512025 9:124241197-124241219 GGCTCCATTCTCTTGGGAGAGGG + Intergenic
1060527221 9:124327434-124327456 GTCCCCCTTACCTAGGGAGTGGG - Exonic
1061755489 9:132809399-132809421 GACTCCCTGCTCTGGGGAAGAGG - Intronic
1062536286 9:137022455-137022477 GTCTTCCTTCTCTCTGGACTCGG - Exonic
1187106946 X:16253114-16253136 CTCTTCCTTTTCTAGGGAGTAGG - Intergenic
1188037815 X:25338267-25338289 GCCTCCCTTGGCTGGGGAGAGGG + Intergenic
1188137196 X:26504851-26504873 GTATGCCCACTCTGGGGAGTGGG - Intergenic
1189102647 X:38207296-38207318 CTCTCCCATCTCTGGGCAATGGG - Intronic
1189103701 X:38216041-38216063 GTGTCCTTTTTCTGGGGAGACGG - Intronic
1189243067 X:39540726-39540748 TTCTCCCCTGTCTGGGGAGCTGG - Intergenic
1189516494 X:41718024-41718046 CTCTCCCCTCTCTGGAGGGTTGG - Intronic
1189659962 X:43286271-43286293 GCCTCCCTTCTTGGTGGAGTGGG + Intergenic
1194403014 X:93461524-93461546 GTCTCCCTGGCCTGGGGAGAAGG + Intergenic
1200180317 X:154146321-154146343 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1200186145 X:154184716-154184738 GTGTCTCTTTTCTGGGGTGTTGG + Intergenic
1200191797 X:154221854-154221876 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1200197552 X:154259658-154259680 GTGTCTCTTTTCTGGGGTGTTGG + Intronic
1200917347 Y:8583032-8583054 GACACCCTTCTCTGGGGTCTCGG + Intergenic
1202575625 Y:26321627-26321649 GTCATTCCTCTCTGGGGAGTGGG - Intergenic