ID: 1028446830

View in Genome Browser
Species Human (GRCh38)
Location 7:90934112-90934134
Sequence TGGGCACTGACCGCCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028446830_1028446840 13 Left 1028446830 7:90934112-90934134 CCTGGAAAGGCGGTCAGTGCCCA 0: 1
1: 0
2: 3
3: 13
4: 136
Right 1028446840 7:90934148-90934170 CGTGAGAGCAGTGGCACAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 186
1028446830_1028446841 14 Left 1028446830 7:90934112-90934134 CCTGGAAAGGCGGTCAGTGCCCA 0: 1
1: 0
2: 3
3: 13
4: 136
Right 1028446841 7:90934149-90934171 GTGAGAGCAGTGGCACAAGAGGG No data
1028446830_1028446835 -10 Left 1028446830 7:90934112-90934134 CCTGGAAAGGCGGTCAGTGCCCA 0: 1
1: 0
2: 3
3: 13
4: 136
Right 1028446835 7:90934125-90934147 TCAGTGCCCAGGAGGCCTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 302
1028446830_1028446838 4 Left 1028446830 7:90934112-90934134 CCTGGAAAGGCGGTCAGTGCCCA 0: 1
1: 0
2: 3
3: 13
4: 136
Right 1028446838 7:90934139-90934161 GCCTTGGGGCGTGAGAGCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028446830 Original CRISPR TGGGCACTGACCGCCTTTCC AGG (reversed) Intronic
900173370 1:1281324-1281346 TGGGGCCTGGCCGTCTTTCCTGG + Intronic
900868070 1:5282877-5282899 TGGCCAGTGACTTCCTTTCCAGG - Intergenic
901656182 1:10770971-10770993 GGGGCAATGACCGCCCCTCCTGG - Intronic
901772581 1:11537833-11537855 TGGGCACTGAGCTCTTTCCCTGG + Intergenic
901925999 1:12566551-12566573 TGGGGACTGACCTCCATTCTAGG + Intergenic
902926756 1:19700899-19700921 GGGACACTGACGGCCTTTTCTGG - Intronic
904867866 1:33596198-33596220 TGGGCTCTGACTTCCTTTCCTGG + Intronic
905402768 1:37715631-37715653 TGAGCACTGAGCACCTTTCCTGG + Intronic
905508651 1:38501141-38501163 TGGGCCCTGACAGCCATGCCAGG - Intergenic
906140432 1:43531079-43531101 GGGTCACTCACCGCCTATCCAGG - Exonic
906917763 1:50029678-50029700 TAGGCACTGGCCGCCATGCCTGG - Intergenic
908413225 1:63887118-63887140 TGGGCACAGACCACCTTTGAGGG + Intronic
910582904 1:88847982-88848004 AGGGCACTGATGGCCTCTCCAGG - Intergenic
911768706 1:101711641-101711663 TGGGCACTGCCTACCTCTCCAGG + Intergenic
912167913 1:107061785-107061807 TTGGCCCTGACAGTCTTTCCAGG - Intergenic
913129035 1:115821519-115821541 TGGCCAATGACAGCCTTTTCAGG - Intergenic
916510333 1:165467601-165467623 TGGGCGCTGATCCCCTCTCCAGG - Intergenic
918080808 1:181206524-181206546 CAGGCACTGACCTCCTTTTCGGG - Intergenic
918268211 1:182868115-182868137 TGGTCTTTGACCCCCTTTCCTGG - Intronic
920108271 1:203569696-203569718 TGGGCACTGTCCTCTCTTCCTGG + Intergenic
922722457 1:227905860-227905882 TGGGCACTGCCTGCCTGCCCTGG + Intergenic
1072906461 10:99458452-99458474 GGGGCACTGTCTGCCTTTGCAGG - Intergenic
1076514086 10:131033419-131033441 GGGGCACTCACCGTCTCTCCTGG + Intergenic
1077860350 11:6172523-6172545 TGGGCAGTAACCTCCTTTCCAGG - Intergenic
1079014833 11:16859789-16859811 TGGGAACTGAATGCCTTTCAAGG - Intronic
1081526332 11:43930177-43930199 TGGACACTAACCACCTTGCCAGG - Intronic
1081654703 11:44849663-44849685 TGGGCCCTGGTCCCCTTTCCTGG - Intronic
1084351434 11:68602747-68602769 GGTGCACTGATCCCCTTTCCTGG + Intronic
1097279310 12:57834743-57834765 GGGGCACAGCCTGCCTTTCCAGG + Intronic
1100819585 12:98418906-98418928 TGGACACCGGGCGCCTTTCCAGG + Intergenic
1106047865 13:26162073-26162095 TGGGGAGAGACTGCCTTTCCAGG + Intronic
1108160323 13:47632265-47632287 TGCTCACTTACCGCCTTTCTTGG - Intergenic
1110108384 13:71709748-71709770 TGGGTACTGTCCGCCATTTCAGG + Intronic
1110794685 13:79622789-79622811 TGGTCACTGAACCTCTTTCCTGG - Intergenic
1113657625 13:112078263-112078285 TGGGCAATGACTGACGTTCCTGG - Intergenic
1113994432 14:16054759-16054781 AGGGCACTGACCCCCTTCACGGG + Intergenic
1115763769 14:36601855-36601877 TGGGCACTCATCGCCTCTGCTGG - Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1121118161 14:91357987-91358009 TGGGCACTCACCGCCTTACATGG - Intronic
1121883161 14:97518261-97518283 TGGGCAGTGACCTGCTTTCAAGG - Intergenic
1122383806 14:101330479-101330501 TAGGCACTGTCTGCATTTCCTGG + Intergenic
1122399776 14:101459501-101459523 GGGGCACCGACGGCCTCTCCTGG - Intergenic
1125715222 15:41815818-41815840 TGGGTACTGACTGCCTCTCATGG + Intronic
1125983444 15:44025809-44025831 TGCTCACTTACCGCCTTTCTGGG + Intronic
1128021073 15:64390920-64390942 CGGGCACTGACCTCCTTCCCAGG - Intronic
1128249057 15:66152136-66152158 TGGGCACTGCCAGCTTCTCCAGG + Intronic
1130046446 15:80449179-80449201 TGTGCACTTACCCCCTTTCTTGG - Intronic
1131245609 15:90789601-90789623 AGGCCACTCACCGCCATTCCTGG + Intronic
1132362342 15:101227024-101227046 TGGGCAGAGGCAGCCTTTCCAGG + Intronic
1133017586 16:2951417-2951439 TGGGCACTGACCGCCCTCCCAGG + Intergenic
1137283143 16:46995042-46995064 TGGTCTCTGCCCACCTTTCCTGG + Intergenic
1140848262 16:78910341-78910363 AGGGCCCTGACAGCCTTTTCTGG + Intronic
1141187196 16:81796420-81796442 TTGGCACGGCCAGCCTTTCCTGG + Intronic
1141425756 16:83943450-83943472 TGGGGACTGACAGCCCTTCCAGG + Intronic
1141540507 16:84716810-84716832 TGGGGAGTGACCGCATGTCCTGG + Intronic
1145999517 17:29122847-29122869 TGGGCACTGTCCCCCGGTCCGGG - Intronic
1155668046 18:28335456-28335478 TGTGCACACACAGCCTTTCCTGG - Intergenic
1158653404 18:59307659-59307681 TGGGCACTGTCTGGCCTTCCAGG + Intronic
1159628576 18:70723079-70723101 TGGGCCTTGACCTCCTTTACAGG - Intergenic
1160801923 19:974270-974292 TGGACACACACCCCCTTTCCAGG + Exonic
1161160114 19:2757124-2757146 TGGGCATTGGGCCCCTTTCCAGG - Intronic
1163700482 19:18784374-18784396 AGGTCTCTGACCACCTTTCCTGG - Intronic
1163829176 19:19539719-19539741 TGTACACGGACCGTCTTTCCAGG - Exonic
1163848824 19:19652260-19652282 GGGGCACTGTCTGCCTGTCCTGG - Intronic
1164762787 19:30740413-30740435 TGGACACTGCCCGCTATTCCCGG + Intergenic
1164922885 19:32102879-32102901 GGGGCACTGACAGTCTTCCCAGG - Intergenic
1166856620 19:45785583-45785605 GGGCCACTCACCGCCTTGCCCGG + Exonic
1167468841 19:49664432-49664454 TGCGTACTAACCGGCTTTCCCGG + Intronic
1168287123 19:55340525-55340547 TGGGCTCTCACCGCCTACCCAGG + Intronic
926239964 2:11077885-11077907 TGGGCACTGCTGGCCTTCCCTGG - Intergenic
928984311 2:37166160-37166182 TGGGCACACACCGCCATGCCTGG + Intergenic
929936876 2:46299311-46299333 TGGGCCCTGCTCCCCTTTCCTGG + Intronic
931253230 2:60551228-60551250 TGCCCACCGCCCGCCTTTCCAGG + Intronic
931983930 2:67723366-67723388 TGGGAATTGACAGCCTTTCTTGG + Intergenic
934965546 2:98718804-98718826 AGGGCCCTGACAGCCCTTCCTGG + Intronic
935132352 2:100270134-100270156 TGGGCAATACCCGGCTTTCCAGG - Intergenic
936287814 2:111194601-111194623 TGGGCACTGACCGAGGTGCCAGG + Intergenic
937248187 2:120507248-120507270 TGGGCTGGGACTGCCTTTCCAGG - Intergenic
937478199 2:122233841-122233863 TGGGCACTAACCGACTTGCCTGG - Intergenic
938537039 2:132255992-132256014 AGGGCACTGACCCCCTTCACAGG - Intronic
942522802 2:176821799-176821821 TGGGCAATGACCACCTGTGCTGG + Intergenic
944769388 2:202898291-202898313 TGGGCACAGACCGCCATACCTGG + Intronic
945059093 2:205892920-205892942 TCGCCACTCACCTCCTTTCCAGG - Intergenic
946318812 2:218936228-218936250 TGGGCTCTGACACCCTGTCCTGG - Intergenic
948899482 2:240949153-240949175 TGGGCACTGAGCTCCATTCCAGG - Intronic
948948723 2:241235356-241235378 TGGGCACTGACTTCCCTTCACGG - Intronic
1169192842 20:3668904-3668926 TGGCCACTGACAGCCACTCCAGG - Exonic
1170181996 20:13541900-13541922 TGGGCACACACCGCCATGCCTGG - Intronic
1171865951 20:30487771-30487793 AGGGCACTGACCCCCTTCACGGG - Intergenic
1174204497 20:48828551-48828573 TGGGCAGTGACGGCCCCTCCCGG + Intergenic
1176083955 20:63287457-63287479 TGGACAGTGACCGCCTTCCCAGG - Intronic
1176163434 20:63660341-63660363 TGGGCAATACCCGGCTTTCCAGG + Intronic
1178086889 21:29121188-29121210 TGGGCAATGACTGTCTTACCTGG + Intronic
1179377263 21:40861808-40861830 TGGCCACTTACTGCCCTTCCTGG - Intergenic
1179906954 21:44427457-44427479 TGGGCACTGGCAGGCTTACCTGG + Intronic
1180098982 21:45575524-45575546 TGGGCAGCCACCGCCTTTGCTGG + Intergenic
1180312660 22:11252645-11252667 AGGGCACTGACCCCCTTCACGGG - Intergenic
1182890182 22:33811645-33811667 TGGGCTCTGGCCTTCTTTCCTGG - Intronic
1183158116 22:36091367-36091389 TGGGGAGTGACTGCCTCTCCTGG - Intergenic
1183333657 22:37234644-37234666 TGGGCAGTGTGAGCCTTTCCCGG - Intronic
1183681809 22:39335400-39335422 TAGGCACCGGCCGCCATTCCTGG + Intergenic
949916070 3:8965669-8965691 TGGCCCCTGAGCTCCTTTCCAGG + Intergenic
952323905 3:32303204-32303226 TGGGAACTGTAGGCCTTTCCTGG + Intronic
953975687 3:47380432-47380454 TGGGCACTGCCCGGCCTCCCAGG + Intergenic
961402129 3:126654938-126654960 GGGGCATCGCCCGCCTTTCCCGG + Intronic
965517305 3:169635099-169635121 TGTGCTCTGACCCCCTTCCCCGG - Intronic
966460866 3:180175012-180175034 TGGGCACTGGCCACCATGCCCGG + Intergenic
973879079 4:55250562-55250584 TGGGTACTGTCCTCCTTACCTGG + Intergenic
980098597 4:128519002-128519024 TGGGCACAGACCCCATGTCCTGG - Intergenic
985881064 5:2639641-2639663 TTAGCACAGACGGCCTTTCCTGG + Intergenic
987847516 5:23305268-23305290 TGTGCACAGACCCCCTCTCCAGG + Intergenic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
997842603 5:137255995-137256017 TGGGCACTGGCAGCCTGGCCAGG - Intronic
998159196 5:139803631-139803653 AGGGCACTGACCCACTCTCCCGG + Intronic
1000301322 5:159959039-159959061 TGGGCACTGACTGCATGCCCAGG + Intronic
1001105721 5:168852450-168852472 TGGGCACTGACCTCCTATCCAGG - Intronic
1005739312 6:28775653-28775675 TTGACACTGCCCGCTTTTCCAGG - Intergenic
1006297931 6:33178297-33178319 TGGACACTCACCGACTCTCCAGG + Exonic
1006479347 6:34279413-34279435 TGGGCACTGACCGTCTAACCAGG + Intergenic
1007406273 6:41637907-41637929 TGGTCACTAACCGGATTTCCCGG + Intronic
1018872798 6:167796174-167796196 GGGGCACTGCCCGCCTGGCCAGG - Intronic
1022497886 7:30864693-30864715 TGGGCAGTGACTGCCTTTTGGGG - Intronic
1024246087 7:47471523-47471545 CGGGCCCTGCCAGCCTTTCCTGG + Intronic
1024599820 7:50970456-50970478 TGGGAACCCACCACCTTTCCAGG + Intergenic
1026057432 7:66996753-66996775 CGGGCACTGGCTTCCTTTCCCGG + Intronic
1026720676 7:72828279-72828301 CGGGCACTGGCTTCCTTTCCCGG - Intergenic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1028638970 7:93022167-93022189 TGGGCACTGATGCCCTTGCCTGG + Intergenic
1029125726 7:98293992-98294014 TGGGCACCGAAGGCCCTTCCGGG + Intronic
1031553438 7:123143035-123143057 AGGGCACTGGCCCCCTTTCCAGG - Intronic
1032791765 7:135247655-135247677 TGGGAACTGACGGCCTTTCAAGG - Intronic
1033606831 7:142933739-142933761 AGGGGACTGACCGCCCTGCCTGG + Exonic
1036696993 8:10981620-10981642 TTAGCACTGACCGCACTTCCAGG + Intronic
1040585936 8:48741260-48741282 TGGGCACTGACCCTTTTTGCTGG + Intergenic
1041709067 8:60876491-60876513 TGGGCACGGAGCGCCTCTGCCGG + Intergenic
1041783344 8:61603048-61603070 TAGGCACTGACCACCATACCTGG - Intronic
1041869898 8:62620801-62620823 TGGGAAATGTCAGCCTTTCCTGG - Intronic
1047540416 8:125759906-125759928 TGGGCAATGAATCCCTTTCCAGG + Intergenic
1049241493 8:141539596-141539618 TGGTCACTGATAGCCTTTCTAGG + Intergenic
1055249272 9:74282656-74282678 TGGCCACAGACAGCCTTTCAGGG + Intergenic
1057442198 9:95090780-95090802 TGGGACCTGACCGTCTTCCCTGG - Intergenic
1057483194 9:95461820-95461842 TGGGCACTGAGGGCGCTTCCAGG - Intronic
1060464148 9:123887585-123887607 TGGGCACTGGCCTCCATTCTCGG - Intronic
1061101495 9:128495935-128495957 AGGGCACTGTGCCCCTTTCCTGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1062449297 9:136608883-136608905 TGGGCACTGGCCCCACTTCCTGG + Intergenic
1062468642 9:136692461-136692483 TGGGCTCCGACGGCCCTTCCTGG - Intergenic
1189913663 X:45836249-45836271 TGGGCACTCACCACCATGCCTGG - Intergenic
1191736379 X:64392986-64393008 TGGGCACTCACAGCCCTGCCAGG + Intronic
1192336783 X:70227986-70228008 TGGGCACAGGCAGCCATTCCTGG + Intergenic
1196064889 X:111453294-111453316 TGGTCACTGAAAGCCTTTCTGGG + Intergenic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic