ID: 1028448585

View in Genome Browser
Species Human (GRCh38)
Location 7:90954107-90954129
Sequence TGCAATGGTATACTATAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028448585_1028448587 -3 Left 1028448585 7:90954107-90954129 CCAATTTATAGTATACCATTGCA 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1028448587 7:90954127-90954149 GCATTATTATTAAAACTGACTGG No data
1028448585_1028448589 13 Left 1028448585 7:90954107-90954129 CCAATTTATAGTATACCATTGCA 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1028448589 7:90954143-90954165 TGACTGGTAGAAAAAAATTAGGG 0: 1
1: 0
2: 0
3: 47
4: 321
1028448585_1028448590 27 Left 1028448585 7:90954107-90954129 CCAATTTATAGTATACCATTGCA 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1028448590 7:90954157-90954179 AAATTAGGGCACTGTAACCATGG 0: 1
1: 0
2: 0
3: 18
4: 129
1028448585_1028448588 12 Left 1028448585 7:90954107-90954129 CCAATTTATAGTATACCATTGCA 0: 1
1: 0
2: 1
3: 11
4: 219
Right 1028448588 7:90954142-90954164 CTGACTGGTAGAAAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028448585 Original CRISPR TGCAATGGTATACTATAAAT TGG (reversed) Intronic
908868045 1:68574589-68574611 TATAATGGAATACTACAAATTGG - Intergenic
909924450 1:81422578-81422600 TGTAATGTTATACTGTATATAGG - Intronic
912792486 1:112665785-112665807 TGCAATGGGATAATATTAAGAGG - Intronic
915819329 1:159005229-159005251 TGTAATGGAATACTATAGACTGG - Intronic
915899242 1:159834529-159834551 TCGAATTGTATACTTTAAATAGG - Exonic
916772086 1:167919578-167919600 TTCAATTGTATATAATAAATTGG - Intronic
916920749 1:169463365-169463387 TGAAATGGTATATTAAAAAATGG + Intergenic
917943897 1:179950178-179950200 TTCAATTGTATGCTTTAAATAGG - Intergenic
919144858 1:193621290-193621312 TCCAATTGTATACTTAAAATGGG + Intergenic
919737475 1:200962067-200962089 TGTAATGGGATATTAGAAATAGG + Intergenic
921140620 1:212302622-212302644 TGGAATTGTATACTTTAAATGGG - Intronic
924184983 1:241478740-241478762 TTCAATTGTACACTTTAAATAGG + Intergenic
1062868995 10:882196-882218 TTCAATTGCATACTTTAAATGGG + Intronic
1063158763 10:3403856-3403878 TGCTATGGCATTCTGTAAATCGG + Intergenic
1063865924 10:10365439-10365461 TGCAAAAGTATACTAGAAAAAGG - Intergenic
1064549256 10:16482229-16482251 TGCAGTGGCTTGCTATAAATTGG + Intronic
1066771553 10:38850328-38850350 TGCAATGGAATACAATAGAATGG + Intergenic
1067971335 10:50974108-50974130 TCCAATGTTATACTGTAACTAGG - Intergenic
1069550076 10:69357958-69357980 TTGAATTGTATACTTTAAATGGG + Intronic
1070310156 10:75267136-75267158 TTGAATTGTATACTTTAAATGGG + Intergenic
1071013138 10:80962717-80962739 TCCAATGGCATACTGTATATGGG + Intergenic
1071584739 10:86809186-86809208 TGGAATTGTATACTTTAAAATGG - Intronic
1074354682 10:112771577-112771599 TTGAATTGTATACTTTAAATGGG - Intronic
1078194753 11:9126287-9126309 TTGAATTGTATACTTTAAATTGG - Intronic
1079459277 11:20665887-20665909 TTGAATTGTATACTTTAAATGGG - Intergenic
1079809916 11:24984599-24984621 TGCAAGGGTTTACTAGAAAAAGG + Intronic
1082057667 11:47833106-47833128 TTGAATGGTATACTTTAAATGGG + Intronic
1083099792 11:60291446-60291468 TGCAATACTATACAATAAATTGG + Intronic
1083526319 11:63369076-63369098 TTCAATTGTATACTTTAAAAGGG + Intronic
1085010131 11:73134003-73134025 TTGAATGGTACACTTTAAATGGG + Intronic
1085017471 11:73184745-73184767 TTGAATTGTATACTTTAAATGGG + Intergenic
1085166428 11:74404519-74404541 TTGAATTGTATACTTTAAATGGG - Intergenic
1085440035 11:76552679-76552701 TTAAACGGTATACTTTAAATGGG - Exonic
1085924551 11:81000377-81000399 AGAAATGGTATAGTAAAAATGGG - Intergenic
1086274111 11:85104675-85104697 TTGAATTGTATACTTTAAATGGG + Intronic
1086631059 11:89020174-89020196 TTCACTTGTACACTATAAATAGG - Intronic
1087038584 11:93776950-93776972 TGAAATGGAATATTATAACTTGG - Intronic
1089369178 11:117941973-117941995 TCTAATTGTATACTTTAAATGGG - Intergenic
1093806323 12:23437406-23437428 TTGAATGGTCTACTCTAAATTGG - Intergenic
1094128922 12:27053859-27053881 TTGAATTGTATACTGTAAATGGG + Intronic
1094466767 12:30761964-30761986 TTAAATTGTATACTTTAAATGGG + Intergenic
1095753187 12:45731940-45731962 TGAAATGGGATACTATAATCTGG + Intronic
1096132554 12:49171583-49171605 TTGAATTGTATACTTTAAATGGG + Intergenic
1097944951 12:65357206-65357228 TGCATTGGTAGACTAGATATGGG - Intronic
1100214299 12:92431790-92431812 TTCAATGGTAAAGTATACATAGG + Intergenic
1100335768 12:93627666-93627688 TTGAATTGTATACTTTAAATGGG - Intergenic
1101704156 12:107205219-107205241 TACAATGGTACATTATAAAAAGG - Intergenic
1102494482 12:113309975-113309997 TTAAATTGTATACTTTAAATGGG + Intronic
1104435329 12:128751546-128751568 TTGAATTGTATACTTTAAATGGG + Intergenic
1105001196 12:132690010-132690032 TGTGATGTTATACTATAATTTGG - Intronic
1105771840 13:23619494-23619516 TCCAATTGTACACTTTAAATGGG + Intronic
1106520581 13:30494019-30494041 TTCAATGGCACACTTTAAATAGG + Intronic
1107003184 13:35575283-35575305 TGCAATTTTATACTGTTAATTGG - Intronic
1107581960 13:41799806-41799828 TTGAATTGTATACTTTAAATAGG - Intronic
1107585043 13:41837211-41837233 TGCAAAGGTTTATTAGAAATTGG - Intronic
1109335034 13:60982765-60982787 TTTAATAGTATACTTTAAATGGG + Intergenic
1113131905 13:107046280-107046302 TGTAATAGAATACCATAAATTGG + Intergenic
1113521313 13:110943449-110943471 TGGAATGGTTTAGTAGAAATAGG + Intergenic
1113866611 13:113530326-113530348 TTGAATTGTATACTTTAAATGGG + Intronic
1117479347 14:56128008-56128030 TGCATGGGTATATTAAAAATGGG + Intronic
1119040097 14:71266423-71266445 TTTAATTGTATACTTTAAATGGG + Intergenic
1121579191 14:95013973-95013995 TATAATGGTGTTCTATAAATCGG + Intergenic
1124704181 15:31947892-31947914 TTCAAGGGTCAACTATAAATTGG - Intergenic
1125234869 15:37501493-37501515 TAAAATGGAAAACTATAAATCGG + Intergenic
1125602855 15:40925134-40925156 TGCAATGGGATAATAATAATAGG - Intergenic
1125788766 15:42346475-42346497 TTTAATTGTATACTTTAAATTGG + Intronic
1125997844 15:44181528-44181550 TTTAATTGTATACTATAAAATGG - Intronic
1126463117 15:48935038-48935060 TTGAATTGTATACTTTAAATGGG + Intronic
1126611947 15:50538609-50538631 TTGAATTGTATACTCTAAATGGG + Intronic
1127209870 15:56762560-56762582 TGGAATTATATACTTTAAATGGG - Intronic
1129792687 15:78352114-78352136 TGGAATTGTATACTTTCAATGGG + Intergenic
1130155629 15:81347752-81347774 GGCAATGCTATTATATAAATTGG - Intronic
1138191574 16:55017863-55017885 TTAAATTGTATACTTTAAATGGG + Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144786259 17:17833620-17833642 TTGAATGATATACTAAAAATGGG + Intronic
1145345097 17:21984411-21984433 TGGAATGGTATAGAATAAAATGG + Intergenic
1146103510 17:30009263-30009285 TTCAATTGTACACTTTAAATGGG - Intronic
1146104323 17:30018086-30018108 TTGAATGGTATACTGTAATTGGG + Intronic
1146139394 17:30351976-30351998 TTTAATTGTATACTTTAAATGGG - Intergenic
1150664211 17:67116076-67116098 TGAAGTGGTAAAATATAAATTGG + Intronic
1203177052 17_KI270729v1_random:26629-26651 TGGAATGGAATACAATAGATGGG + Intergenic
1203177079 17_KI270729v1_random:26804-26826 TGGAATGGAATACAATAGATGGG + Intergenic
1203201408 17_KI270729v1_random:278615-278637 TGCAATGGAATAGAATAGATTGG + Intergenic
1203211003 17_KI270730v1_random:79316-79338 TGCAATGGAATAGAATAGATTGG + Intergenic
1152999933 18:445486-445508 TTGAATTGTATACTTTAAATGGG - Intronic
1153792596 18:8593523-8593545 TACAATGGTAGAATATGAATTGG + Intergenic
1155462171 18:26095069-26095091 TGCAATGTAATAATATAATTAGG + Intergenic
1156709127 18:39920342-39920364 TGGACAGGTATCCTATAAATAGG + Intergenic
1157367623 18:47080343-47080365 TTGAATCGTATACTCTAAATGGG - Intronic
1158510269 18:58084367-58084389 TTTAATTGTATACTCTAAATGGG + Intronic
1161306309 19:3570783-3570805 TGGAATTGTATGCTCTAAATGGG - Intronic
1168527769 19:57102527-57102549 TGCTATGTTCTACCATAAATTGG + Intergenic
927946839 2:27139806-27139828 TCGAATGGTACACTTTAAATGGG - Intergenic
929220497 2:39459921-39459943 TGCAATTGTATTCTTTAAATAGG + Intergenic
930099639 2:47592992-47593014 TGGAATTGTATACTTTAAAATGG + Intergenic
930213874 2:48672802-48672824 TTGAATTGTATACTTTAAATAGG - Intronic
931151615 2:59580531-59580553 TGCAATGGTTTACAATGGATTGG + Intergenic
931266290 2:60663242-60663264 TTGAATTGTATACTTTAAATAGG - Intergenic
931735899 2:65193705-65193727 TCGAATTGTATACTTTAAATGGG + Intergenic
932555574 2:72821916-72821938 TTTAATTGTATACTTTAAATGGG + Intronic
933204955 2:79496111-79496133 TTGAATTGTATACTTTAAATGGG + Intronic
935144410 2:100385200-100385222 TGCCAAGGTATACAATATATGGG + Intergenic
937481680 2:122268096-122268118 TGAAATTGTATACTTTAAAATGG - Intergenic
937627410 2:124058575-124058597 TACAATGGTATACTAGACTTGGG - Intronic
940092147 2:149932708-149932730 TGAAATGGTTTGCTAAAAATTGG - Intergenic
940252793 2:151698268-151698290 TTGAATTGTATACTTTAAATTGG - Intronic
940787440 2:157997328-157997350 TTCAATGGTATATTATAAAATGG - Intronic
941135099 2:161706002-161706024 AGCAATGGTTTTCTAAAAATGGG + Intronic
942705591 2:178768231-178768253 TTGAATTGTATACTTTAAATTGG - Intronic
943568856 2:189548537-189548559 TTCAGTTGTATACTTTAAATGGG - Intergenic
944212771 2:197223495-197223517 TGCAATGGAATACTATATGAGGG - Intronic
945215389 2:207428238-207428260 TGGAATTGTACACTTTAAATAGG + Intergenic
946364288 2:219239005-219239027 TGTAAAGGTATCCCATAAATTGG - Intronic
947240872 2:227993225-227993247 TGGCATGGTATAATTTAAATGGG + Intronic
1168900400 20:1359032-1359054 TGGAAATGTATACTTTAAATGGG - Intronic
1170036146 20:11992341-11992363 TGCTGTGGTATACTAGAAAATGG - Intergenic
1170258848 20:14379389-14379411 TCGAATTGTATACTTTAAATGGG - Intronic
1170685392 20:18565102-18565124 TCCAATTGTATGCTTTAAATGGG - Intergenic
1174309445 20:49640006-49640028 TTGAATGATATACTCTAAATGGG - Intronic
1176757418 21:10735847-10735869 TGGAATGGAATGCAATAAATTGG - Intergenic
1178838880 21:36122458-36122480 TTGAATTGTATACTTTAAATGGG + Intergenic
1178958028 21:37041111-37041133 TTTAATTGTATACTTTAAATGGG - Intergenic
952630815 3:35464257-35464279 GCCAATAGTCTACTATAAATAGG - Intergenic
953263823 3:41366671-41366693 TACAATGGTATAATATACAATGG - Intronic
956178010 3:66492317-66492339 TTCAATGGCAAATTATAAATTGG + Intronic
956287101 3:67622155-67622177 TCCAATGGAATACTGTAAAATGG + Intronic
959783268 3:110262221-110262243 TGTAGTGAAATACTATAAATAGG + Intergenic
961606947 3:128102791-128102813 TGGAATTGTATACTTAAAATGGG + Intronic
961799006 3:129430100-129430122 TGTGATGGTAAACTATAAAGTGG + Intergenic
963740306 3:149073253-149073275 TGCACTGGCATACTATAGCTTGG + Exonic
964505994 3:157399893-157399915 TGTAATGCTATTCTAAAAATCGG - Intronic
965509445 3:169552148-169552170 TGAAATTGTATACTTTAAAAAGG + Intronic
972938076 4:44164140-44164162 CTGAATGGTATACTTTAAATAGG + Intergenic
972944773 4:44240858-44240880 TGCAACTGTATAAAATAAATGGG + Intronic
973176180 4:47208550-47208572 TTGAATTGTATACTTTAAATGGG + Intronic
973356628 4:49136266-49136288 TGGAATGGAATACAATAAAATGG - Intergenic
973917419 4:55649703-55649725 TGAAATGGAATACAATAAAAAGG - Intergenic
973948135 4:55981760-55981782 TGAAATGGTATACTTTAAGTGGG - Intronic
974555335 4:63439476-63439498 TTCAATTGTGTACTTTAAATAGG + Intergenic
975607031 4:76165200-76165222 TGCAAAGAGATCCTATAAATTGG + Intronic
975872798 4:78799731-78799753 TACAGTGATATGCTATAAATGGG + Intronic
976570734 4:86606660-86606682 TGCAATGCAATTCAATAAATAGG + Intronic
977518602 4:98053126-98053148 TGGAAAGGTATGGTATAAATGGG - Intronic
978170234 4:105660863-105660885 TCAAATTGTATACTTTAAATAGG - Intronic
979309846 4:119190522-119190544 TGCAGTGGTAAGCTATAACTGGG - Intergenic
979319379 4:119304402-119304424 TGTAATGGTCTCCTATTAATGGG + Exonic
982559246 4:156909215-156909237 TGTAATTGGATACTTTAAATGGG + Intronic
983152205 4:164298445-164298467 TGTAATGGGTTACTTTAAATGGG - Intronic
984226251 4:177038759-177038781 TGAAATTGTAGACTAAAAATAGG - Intergenic
984480213 4:180291285-180291307 TACAATGATATACCATAATTAGG - Intergenic
985178673 4:187231679-187231701 TACAATGTTTTAGTATAAATGGG - Intergenic
986952629 5:13109091-13109113 TGCAATGGTATCCTATGAGTGGG - Intergenic
987613086 5:20234054-20234076 TGCAATGGTATAAGAGAAATGGG + Intronic
989289295 5:39743984-39744006 TTTAATGGTACACTTTAAATGGG - Intergenic
989300044 5:39880111-39880133 TCCAATGCTATACTTAAAATAGG + Intergenic
990159070 5:52916400-52916422 TGCATTGGTTTACTGTAATTCGG + Intronic
991236171 5:64400441-64400463 TTTAATTGTATACTTTAAATGGG + Intergenic
991975616 5:72181406-72181428 TTCACTAGTACACTATAAATGGG - Intronic
992517479 5:77509804-77509826 TTAAATTGTATACTTTAAATGGG + Intronic
993528746 5:88999756-88999778 TGAAGTGCTACACTATAAATTGG + Intergenic
996854344 5:127988174-127988196 TGCAATGGTAAATTACAAGTAGG - Intergenic
998861267 5:146446762-146446784 TGCAACGGTTTAGTATAATTTGG + Intergenic
998959930 5:147474807-147474829 CGGAATTGTATACTTTAAATTGG - Intronic
999617394 5:153438753-153438775 TTTAATTGTATACTTTAAATGGG - Intergenic
1000198090 5:158979489-158979511 TGCGATGGTAAATTATAAATCGG + Intronic
1000234926 5:159348851-159348873 TTGAATTGTATACTTTAAATGGG - Intergenic
1000355995 5:160396371-160396393 TGCAAAGGTAGGCTACAAATTGG + Intronic
1001791218 5:174459391-174459413 TGTAAAGGTATAGTATGAATTGG - Intergenic
1003219503 6:4146215-4146237 TGCAATGGAATATTTTAAAATGG - Intergenic
1005211338 6:23467878-23467900 AGCAATGGTGTACTTTAAAAGGG + Intergenic
1006038232 6:31230806-31230828 TTGAATTGTATACTTTAAATGGG + Intergenic
1010409827 6:75548390-75548412 TATAATTTTATACTATAAATTGG + Intergenic
1010533885 6:77001449-77001471 TGAAATGGTATTCTATAAATTGG + Intergenic
1014783908 6:125596378-125596400 TGCAATGTAATACTATGAAAAGG - Intergenic
1016326551 6:142909344-142909366 AGCAATGGTATAGTATACATTGG + Intronic
1018405529 6:163477862-163477884 TGTAATGATATACTAAAAGTTGG + Intronic
1019755958 7:2770180-2770202 TGCCATAATATACTATAAACAGG + Intronic
1020018724 7:4848293-4848315 TTCAATTGTATACTAAAAACAGG + Intronic
1020675680 7:11182312-11182334 TTGAATTGTATACTTTAAATGGG + Intergenic
1021240947 7:18200537-18200559 TCCAATGTGATACTATAGATTGG - Intronic
1022211759 7:28217726-28217748 TGCAATTGTACACTTTGAATGGG - Intergenic
1023647594 7:42335083-42335105 TTAAATGGTACACTTTAAATGGG + Intergenic
1025237727 7:57245858-57245880 TTCAATGGTACACTTAAAATGGG + Intergenic
1025480162 7:60972936-60972958 TACAATGTTACACTATAATTGGG + Intergenic
1026050012 7:66938420-66938442 TTGAATTGTATACTTTAAATGGG + Intronic
1027746992 7:82088723-82088745 GTGAATGGTATTCTATAAATTGG + Intronic
1028241290 7:88424246-88424268 TTCAACTGTATACTTTAAATGGG - Intergenic
1028448585 7:90954107-90954129 TGCAATGGTATACTATAAATTGG - Intronic
1029958555 7:104665995-104666017 TGTAATGGAATATTGTAAATAGG - Intronic
1030015505 7:105216138-105216160 CTGAATGGTATACTTTAAATGGG + Intronic
1030880523 7:114872658-114872680 AACAATGTTATACCATAAATTGG - Intergenic
1030984872 7:116229752-116229774 TGTAATTTTATAATATAAATTGG + Intronic
1033265544 7:139883400-139883422 TGAACTGGTATAAAATAAATGGG - Intronic
1033931216 7:146524778-146524800 TGCTATGGTTTACTTTAAAAAGG - Intronic
1036097004 8:5735534-5735556 TGCAATGCACTACTAGAAATGGG - Intergenic
1038704185 8:29878698-29878720 AGCCGTGGTATAGTATAAATTGG - Intergenic
1039802651 8:40973367-40973389 TGCAAAGGTATTTTATAGATGGG - Intergenic
1041598961 8:59692697-59692719 TGCAATAGTATAATATAATAGGG - Intergenic
1042398557 8:68318868-68318890 TTCAATTGTACACTTTAAATAGG - Intronic
1043242248 8:77949325-77949347 TGCAACTGTATACTCAAAATTGG - Intergenic
1044691448 8:94883800-94883822 TGGAATGGTATAGTGTAAAAGGG + Intronic
1045257522 8:100540878-100540900 TGTAATGATAGACTATAAACTGG - Intronic
1045882206 8:107054490-107054512 TTAAATTGTATACTTTAAATAGG + Intergenic
1045986171 8:108251953-108251975 TGGAACTGTATACTTTAAATGGG - Intronic
1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG + Intronic
1046743427 8:117852197-117852219 TGCAATTGTGTACAATAACTTGG - Intronic
1049934249 9:485341-485363 TTGAATTGTATACTTTAAATGGG - Intronic
1050732717 9:8727877-8727899 TTGAATTGTATACTTTAAATGGG - Intronic
1050847543 9:10241475-10241497 TGCATGGCTATACTATAATTTGG - Intronic
1051581772 9:18683903-18683925 TGCAATTGTATGTTATAAAATGG + Intronic
1053325387 9:37142196-37142218 TGTTATGATATACTGTAAATAGG + Intronic
1054730310 9:68695724-68695746 TTGAATTGTATACTCTAAATAGG - Intergenic
1056373689 9:85985705-85985727 TTGAATTGTATACTTTAAATAGG + Intronic
1057539795 9:95956404-95956426 TGTAATGGTTTACCACAAATGGG + Intronic
1059355271 9:113694401-113694423 TTGAATTGTATACTTTAAATGGG + Intergenic
1059593348 9:115688951-115688973 TGCAAGAGAATACTATAAACTGG + Intergenic
1203342994 Un_KI270442v1:11288-11310 TGCAATGGAATACAATACAATGG + Intergenic
1203681252 Un_KI270756v1:66029-66051 TGCAATGGAATACAATAGAATGG - Intergenic
1185986134 X:4836423-4836445 TTGAATTGTATACTTTAAATGGG - Intergenic
1186966600 X:14793486-14793508 TAGAATTGTATACTCTAAATGGG + Intergenic
1187068839 X:15867705-15867727 TTGAATTGTATGCTATAAATGGG - Intergenic
1187146209 X:16639693-16639715 TCTAATGGTTTTCTATAAATAGG - Intronic
1187516110 X:19972528-19972550 TTGAATTGTATACTTTAAATGGG - Intergenic
1188372371 X:29384996-29385018 TAGAATGGTACACTTTAAATGGG - Intronic
1189758660 X:44298550-44298572 TGGAATTGTATACTTAAAATAGG + Intronic
1190422822 X:50302495-50302517 TTGAATTGTATACTTTAAATGGG - Intronic
1192595284 X:72400657-72400679 TTGAATTGTATACTATGAATGGG - Intronic
1196751748 X:119124371-119124393 TTGAATTGTATACTTTAAATAGG + Intronic
1198405964 X:136312695-136312717 TTGAATTGTATACTTTAAATGGG - Intronic
1199052390 X:143252191-143252213 TGCAATGGGATAGTAGAAAATGG - Intergenic
1201197454 Y:11508257-11508279 TGGAATGGAATACTATGAAATGG + Intergenic
1201232802 Y:11881063-11881085 TGCCATGTTATACTTTACATGGG + Intergenic