ID: 1028451376

View in Genome Browser
Species Human (GRCh38)
Location 7:90988501-90988523
Sequence GCTTATTTTGCAACTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028451376_1028451378 -3 Left 1028451376 7:90988501-90988523 CCTCCATTAGTTGCAAAATAAGC 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1028451378 7:90988521-90988543 AGCAGCAAATGCATTCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028451376 Original CRISPR GCTTATTTTGCAACTAATGG AGG (reversed) Intronic
916003146 1:160635515-160635537 GCTTATTTAGCAACTATTATAGG + Intronic
916990809 1:170242854-170242876 GCTTCCTTTGCAACTATAGGTGG + Intergenic
919746974 1:201014732-201014754 GCTTAGTTAGGAACTAAGGGAGG - Intronic
924782247 1:247161394-247161416 GATTATTGTCCAACTAATAGAGG - Intronic
1064542837 10:16422649-16422671 TCTTATTTTGCAGCTAATTTTGG - Intergenic
1067670430 10:48315897-48315919 GCTCATTTTACATATAATGGAGG - Intronic
1071303327 10:84274268-84274290 GCTTGTTTTGCCAGTCATGGAGG + Intergenic
1074227430 10:111499054-111499076 GCTTAATTTCCAAGTAATTGGGG - Intergenic
1076308029 10:129478464-129478486 GCTTATGTGGCTACTGATGGGGG + Intronic
1076509361 10:131001220-131001242 TATTTTTTTGCATCTAATGGAGG - Intergenic
1077644691 11:3912809-3912831 GCTTCCTTTGCAACTAAGTGTGG + Intronic
1087123900 11:94604293-94604315 GCATATTTTGCAACTCATTGGGG + Intronic
1089094078 11:115903821-115903843 GTTCATTTTGGAACTAAGGGTGG + Intergenic
1105990315 13:25614468-25614490 GCTTATTTAGCTACTCAAGGAGG - Intronic
1106894794 13:34288298-34288320 GCTAATGTTGCAAGTATTGGAGG + Intergenic
1108035629 13:46287589-46287611 GCTTAATTTGCATCCTATGGAGG + Intergenic
1109271861 13:60264704-60264726 GCTTATTTTGCCCCTACTGTTGG + Intergenic
1110420361 13:75300911-75300933 GCTGATTGTGCCACTAATTGTGG - Intronic
1110437532 13:75492194-75492216 GCCTGTCTTGAAACTAATGGTGG + Intergenic
1112694168 13:101928939-101928961 GCCTATTTTGCAAACATTGGAGG - Intronic
1114341113 14:21745685-21745707 GCTTAATTTGCAAATATTTGGGG - Intergenic
1115270075 14:31541632-31541654 GCTTACCTTGTAACTAAGGGTGG + Intronic
1115648735 14:35388075-35388097 GCTTATTTTGCAAATAAAGCTGG + Intergenic
1118034809 14:61855242-61855264 GTTTATCTTGCACCTATTGGTGG + Intergenic
1119944181 14:78674322-78674344 GATTATTCTGCAAATAATGGGGG + Intronic
1120004424 14:79340876-79340898 GCTTATTTCTCAACTGATGAGGG - Intronic
1128422304 15:67505083-67505105 GTTTATTTCGCAACCAATGGAGG - Intergenic
1129043283 15:72709169-72709191 GCTTATTTTGCAGCTCAGGTGGG + Intronic
1131264672 15:90908929-90908951 CCTTATTTTGCTAGAAATGGAGG + Intronic
1140922273 16:79550399-79550421 ACCCATTTTGCAACTCATGGTGG - Intergenic
1141257465 16:82415924-82415946 CATTTTGTTGCAACTAATGGAGG + Intergenic
1142909451 17:3075169-3075191 GGCTTTTATGCAACTAATGGTGG + Intergenic
1142925103 17:3228939-3228961 GGCTTTTATGCAACTAATGGTGG - Intergenic
1143156100 17:4837274-4837296 GCATGTTTTGCACATAATGGGGG + Intronic
1143987908 17:10930992-10931014 GTTTATTTTGCGGCTAATGAAGG - Intergenic
1151423678 17:74015781-74015803 GCTTGTTTTACAACCACTGGAGG + Intergenic
1153182615 18:2452519-2452541 GTTTATTTTGCAACTAATCAAGG - Intergenic
1155051947 18:22156269-22156291 GATTTTTTTGCAATTAAGGGGGG - Intergenic
1155858185 18:30861969-30861991 GCTTATTTTCCAACTACAGAAGG + Intergenic
1156152848 18:34264075-34264097 TCTTACTTTTCTACTAATGGGGG - Intergenic
1159647671 18:70938483-70938505 GCTCATTTTGAAACCAAGGGTGG + Intergenic
1164645038 19:29852770-29852792 GTTTATTGTACAACAAATGGGGG + Intergenic
1164659605 19:29951414-29951436 GTTTATTGTGAAACTAAAGGGGG - Intronic
1166273782 19:41736627-41736649 ACTTATTTTGCAAATAATTTGGG - Intronic
1166403092 19:42498519-42498541 GCTTATTCTGCAATTAGTGAAGG - Intergenic
925610088 2:5695506-5695528 GCATATTTTGTAGCAAATGGTGG + Exonic
928417866 2:31111585-31111607 GCTTTTTTTGCAATTTGTGGTGG - Intronic
930157441 2:48119841-48119863 GTTTTTTTTTCAAATAATGGAGG - Intergenic
931532614 2:63233239-63233261 CCATATTTTGCAACTAATTTGGG - Intronic
936793044 2:116172846-116172868 CCTTGTTTTGAAACTAATGTTGG - Intergenic
938824216 2:134989146-134989168 GCTTAGTTTGAAACTAGAGGAGG - Intronic
941429936 2:165401564-165401586 GCTTATTTTGCAACTATTTTAGG + Intergenic
941828346 2:169925132-169925154 GCTAATTTTCCAAATATTGGAGG - Intronic
941909633 2:170751632-170751654 GCTTAGTTTTCAAATAATTGGGG - Intergenic
944522934 2:200589753-200589775 GCTCATTGTGCAAATAATGCAGG - Intronic
947335229 2:229075709-229075731 GCTTAATTGACAACGAATGGAGG - Intronic
1169850531 20:10044511-10044533 GCTCATTTTGCTGCTAAAGGAGG + Exonic
1170825407 20:19790448-19790470 GTTAATTTTTCAACTAATGTTGG + Intergenic
1173821667 20:46023546-46023568 CTTTATTTTGCAAGTGATGGGGG - Intronic
1174681128 20:52409708-52409730 CATTGTTTTCCAACTAATGGAGG - Intergenic
1174846001 20:53943917-53943939 GGTTATTTTGCAACACAAGGGGG - Exonic
1176815401 21:13595913-13595935 GCTGCTCTTGCAACTAAAGGTGG + Intergenic
1177045136 21:16159928-16159950 TCTTTTTTTGCAAAAAATGGGGG - Intergenic
1178213379 21:30563676-30563698 ACTCATTTTGCAATTATTGGGGG - Intergenic
1179299184 21:40091064-40091086 GCCTTTCTTACAACTAATGGCGG - Intronic
1181395237 22:22616653-22616675 GCTTATTGCACAAGTAATGGAGG + Intergenic
949428981 3:3952481-3952503 ACGTATTTTTCAACTCATGGAGG + Intronic
952500160 3:33954162-33954184 TCTTATTTTACAAATAATGCAGG + Intergenic
954445823 3:50546411-50546433 GTTTAATTGGCAACTAATGAGGG + Intergenic
958623323 3:96591831-96591853 ACTTTTATTGCAATTAATGGTGG - Intergenic
960142923 3:114168452-114168474 GCTTCCTTTGCAGCTAAAGGTGG + Intronic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
965067198 3:163864944-163864966 GCTTATTTTCCTAATATTGGTGG - Intergenic
966703767 3:182887678-182887700 GCTTATTTTGTAACACATGAGGG - Exonic
970021545 4:11574797-11574819 GCTTATTTTCAAACTCATGAGGG + Intergenic
970754219 4:19404804-19404826 CCTTGTTTTCCAACTAAGGGTGG - Intergenic
971619721 4:28840742-28840764 GCTTATTTTGAAACTGAAGATGG + Intergenic
971907209 4:32742340-32742362 GCATATTTAGCAATTAATGTCGG - Intergenic
971973844 4:33657708-33657730 GCTTATATTGTAAGTAATAGAGG - Intergenic
976410551 4:84708334-84708356 GATTAATTTGCATCTATTGGTGG - Intronic
977134380 4:93284183-93284205 GATTCTTTTGCATCTAAGGGTGG + Intronic
983152360 4:164300491-164300513 TCATATTTTGCAACTGATGAAGG + Intronic
987558843 5:19491266-19491288 GCTTGATTTGCAACTTAGGGTGG + Intronic
987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG + Intronic
988338046 5:29931671-29931693 GGTTAATTTGCAACTACTCGTGG + Intergenic
990223360 5:53621104-53621126 ACTTATTTTGAAACTACTGTTGG + Intronic
994157906 5:96523902-96523924 GCTTCTTTTGCAGCTAATTGTGG - Intergenic
995249699 5:109978193-109978215 GCTTAGTTTTCAAGCAATGGAGG + Intergenic
997373565 5:133380978-133381000 GCTTTTTCTGCAACTACTGAGGG - Intronic
1000499233 5:162027920-162027942 GCTTTTTTTGCATCTATTGATGG - Intergenic
1002932859 6:1646370-1646392 TTTTATTTGGCAAGTAATGGAGG - Intronic
1002955422 6:1858245-1858267 GCTTACTTTGCAAGAAATGAGGG - Intronic
1003166559 6:3684333-3684355 TCTTATTTTCCAACAAATGTGGG - Intergenic
1003863355 6:10341954-10341976 GTTTATTTTGCAGGTAATAGTGG - Intergenic
1004449698 6:15733899-15733921 GCTTATTTAGCAGCAAATGGTGG - Intergenic
1006623207 6:35381684-35381706 GCCTCCCTTGCAACTAATGGAGG - Intronic
1006822240 6:36906283-36906305 GCTTATTTTGCAAATAAAAGAGG - Intronic
1011138551 6:84127351-84127373 GCATGTTTTTCAACTAATGTAGG - Intronic
1011972106 6:93238425-93238447 GCTTTATTTGCCATTAATGGAGG + Intergenic
1013307844 6:108866315-108866337 GATTATTTTGCAACAAAGTGGGG + Intronic
1016493327 6:144631386-144631408 GCTTATATTCCAAATATTGGAGG + Intronic
1023268792 7:38437019-38437041 GCTCATTTTGCAGCAAATGTTGG - Intronic
1027335891 7:77149960-77149982 TCTTTTTTTTCAACAAATGGCGG + Intronic
1027504195 7:78994861-78994883 ACTTATTTTGCAAATCAGGGTGG - Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1033201080 7:139370864-139370886 GCTTATGTTGGAAGAAATGGAGG + Intronic
1045102302 8:98857354-98857376 GTTTATTTTGCAATTAATGAAGG + Intronic
1047674547 8:127185853-127185875 GCTTCTCTTGCAATTAATTGTGG - Intergenic
1048271769 8:133034537-133034559 CGTTATTCTGCAAATAATGGCGG + Intronic
1050846476 9:10226896-10226918 CCTTATTTTTCAACTATTTGGGG + Intronic
1051185970 9:14461717-14461739 GCTTATTTTCCAGGTAATGAAGG + Intergenic
1052509386 9:29395919-29395941 ACTTATTTTCCAACTGATGGTGG + Intergenic
1055084745 9:72302571-72302593 ACTTATTTTGCAAATATCGGTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1055873204 9:80910528-80910550 AATTATTTTTCAACTAATGAAGG - Intergenic
1057400570 9:94719748-94719770 GTTTATTTTACAGCTAAGGGTGG - Intergenic
1060134140 9:121135462-121135484 GCTTATTTTTCATCTGATGTTGG - Intronic
1203531958 Un_GL000213v1:153528-153550 GCTGCTCTTGCAACTAAAGGTGG - Intergenic
1187460618 X:19483773-19483795 GGACATCTTGCAACTAATGGTGG - Intronic
1195755792 X:108197495-108197517 GCTTATTATGAAAGTAAAGGAGG + Intronic
1196133212 X:112180007-112180029 GCGTATTTTGCATCTAATTGAGG + Intergenic
1199097030 X:143755989-143756011 ACTTTTTTAGCTACTAATGGTGG + Intergenic
1199200125 X:145077097-145077119 GTTTATTTTGTATCTACTGGAGG - Intergenic