ID: 1028453676

View in Genome Browser
Species Human (GRCh38)
Location 7:91015305-91015327
Sequence TGTACATTCTTCACTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028453669_1028453676 5 Left 1028453669 7:91015277-91015299 CCCTGTTTTCACTCCCTTACCCA 0: 1
1: 1
2: 1
3: 28
4: 312
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1028453671_1028453676 -8 Left 1028453671 7:91015290-91015312 CCCTTACCCAAGTTCTGTACATT 0: 1
1: 0
2: 2
3: 107
4: 604
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1028453672_1028453676 -9 Left 1028453672 7:91015291-91015313 CCTTACCCAAGTTCTGTACATTC 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1028453667_1028453676 21 Left 1028453667 7:91015261-91015283 CCTTCCTCAAGACACTCCCTGTT 0: 1
1: 0
2: 0
3: 15
4: 248
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1028453668_1028453676 17 Left 1028453668 7:91015265-91015287 CCTCAAGACACTCCCTGTTTTCA 0: 1
1: 0
2: 3
3: 19
4: 249
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125
1028453670_1028453676 4 Left 1028453670 7:91015278-91015300 CCTGTTTTCACTCCCTTACCCAA 0: 1
1: 0
2: 0
3: 23
4: 226
Right 1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG 0: 1
1: 0
2: 1
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028453676 Original CRISPR TGTACATTCTTCACTGCTAT GGG Intronic
903322799 1:22552842-22552864 TGTCCTTTCTTCTCTGCTCTGGG - Intergenic
908127556 1:61046127-61046149 TGTATATTCTACACTGTTCTAGG - Intronic
908439649 1:64141104-64141126 TGTACAACCTTCACCACTATAGG - Intronic
910133029 1:83931968-83931990 TGTTCATTATTCACAGCTCTTGG + Intronic
910559580 1:88576189-88576211 TGTACTTTCTTGCCTCCTATTGG - Intergenic
911384543 1:97158530-97158552 TGGACATTCTTCAGTGCATTTGG - Intronic
915942493 1:160127644-160127666 TGTTCAATCTCCATTGCTATGGG - Exonic
918784649 1:188750130-188750152 TTTCCATTCTTCACTGCCCTAGG - Intergenic
921392509 1:214630783-214630805 TGTACATTCTCCACTTTGATAGG - Intronic
922399376 1:225236693-225236715 TTGACATTCTTCACAGGTATAGG - Intronic
924308968 1:242720426-242720448 TGTGGTTTCTACACTGCTATGGG + Intergenic
924620260 1:245654190-245654212 TTTACATTCTTCATTGCCATGGG - Intronic
1065491672 10:26288525-26288547 TTTACATTCTTGACTGCTTTGGG - Intronic
1068162696 10:53286744-53286766 TATGCAATCTTAACTGCTATGGG - Intergenic
1069241640 10:66147131-66147153 TGTAAATTCTTCTCTGGTAATGG - Intronic
1075274045 10:121077577-121077599 TGAACTGTCTTCACTGCCATGGG - Intergenic
1075623035 10:123941606-123941628 TTAACATTATTCACTGTTATGGG - Intergenic
1075779923 10:125010833-125010855 TGTACATCCTTAGCAGCTATAGG + Intronic
1084061176 11:66676247-66676269 TTTATATTCTTTACTGCTTTGGG - Intronic
1086431436 11:86740507-86740529 TATCCAGTCTGCACTGCTATAGG - Intergenic
1088703761 11:112441048-112441070 GGTAAATTCTTGACTGCAATAGG + Intergenic
1088914195 11:114214871-114214893 TGTGCCTTCTTCTCTGCTTTAGG - Intronic
1095339386 12:41070477-41070499 TGTACTTTCCTCACTGTTTTGGG + Exonic
1097741884 12:63252930-63252952 GGTACATTCTTGACTGCAACAGG - Intergenic
1099941624 12:89195869-89195891 TGTGCATTCTTCCATGCTCTGGG - Intergenic
1101444540 12:104728272-104728294 TTTACATTAGTCACAGCTATGGG - Intronic
1104320468 12:127746002-127746024 TGTGCATGTTTCCCTGCTATTGG - Intergenic
1107249719 13:38345200-38345222 GCTATATTCTTCACTGGTATAGG - Intergenic
1107581403 13:41791971-41791993 TGTAATTTCATCACTGCTGTTGG - Intronic
1111803773 13:93012806-93012828 TGTTCCTTCATCATTGCTATGGG - Intergenic
1115676047 14:35675906-35675928 TGTACATTCTTTACTCCTAATGG + Intronic
1117152917 14:52907492-52907514 TTTAAATACTTCACTGCTTTAGG + Intronic
1118136891 14:63038913-63038935 TTTACATTCTGCTTTGCTATTGG + Intronic
1120189710 14:81429611-81429633 TGTCCTTTCTTGACTGCCATCGG - Intronic
1125966769 15:43881090-43881112 TGGACATTCTTCCCTGTTCTGGG + Intronic
1126538850 15:49800169-49800191 TGCAGGTTCTTCACTGCTCTAGG + Intergenic
1126832266 15:52620197-52620219 AGTAAATTCTTCATTGCTAGAGG + Intronic
1127861847 15:63000256-63000278 TGGACATTGTTTACTGCAATGGG + Intergenic
1127865894 15:63032355-63032377 TGTACATTGTTAACAGCAATAGG - Intergenic
1140543043 16:75777409-75777431 TCTACATTCATCAGTGATATTGG - Intergenic
1140564127 16:76021115-76021137 TCTCCATTCTTCACTGAGATTGG - Intergenic
1140681014 16:77384664-77384686 AGTACAATCTTCACTGCTACAGG - Intronic
1144787673 17:17840796-17840818 TGCATATCCTTCACTGCTGTGGG + Intergenic
1149553965 17:57559929-57559951 GGTAACTCCTTCACTGCTATTGG + Intronic
1151087201 17:71393774-71393796 TGAACATTTTTAACTGCTTTTGG - Intergenic
1154219749 18:12441589-12441611 TATACATTCTTCTTTGCTTTGGG - Intergenic
1157714174 18:49871776-49871798 TGTGCATTCCTCCCTGCCATGGG + Intronic
1159638261 18:70832587-70832609 TGTATGTTCTTCACAGATATTGG + Intergenic
1164998454 19:32740873-32740895 TGTGCAGTCTTCACTGCTTCTGG + Intronic
1165983144 19:39743037-39743059 TGTATATTCATCAGTGATATTGG + Intergenic
926404763 2:12539942-12539964 TGTACATAATTCACTCCTCTTGG + Intergenic
927526926 2:23752530-23752552 TGTTCAATCTTCAATGTTATGGG - Intronic
928712902 2:34027757-34027779 TGTACATTTCTAACTGCTATAGG + Intergenic
930016664 2:46975424-46975446 TGGACATCCTTCCCTGCTCTCGG + Intronic
930350281 2:50244314-50244336 TGTGCAGTCTTTGCTGCTATTGG - Intronic
930840580 2:55840880-55840902 TGTACATTATTCACTAAGATAGG - Intergenic
931057056 2:58484016-58484038 TGTTTATTCTTGACTGCTTTGGG + Intergenic
934040394 2:88123529-88123551 TTTATATGCTTCACAGCTATAGG - Intronic
939919958 2:148098121-148098143 TCCACATTCTTCACTGCAACTGG - Intronic
941204325 2:162552770-162552792 TGTTTATTCATCACTGCTTTCGG - Intronic
943301196 2:186203118-186203140 TCTATATTCATCAGTGCTATTGG - Intergenic
1169597102 20:7212841-7212863 TGTACATATTTATCTGCTATTGG + Intergenic
1171192850 20:23171803-23171825 GGAACATTCTACACTGCTGTTGG - Intergenic
1174908726 20:54582284-54582306 TGTATATTCATCAGTGATATTGG + Intronic
1177070033 21:16493386-16493408 TGGCCATTCTTCATTGCTTTAGG + Intergenic
1180164229 21:46012809-46012831 TGTACAATGTTCATAGCTATGGG - Intergenic
1182855433 22:33513135-33513157 TTTACATTCCTCACTTCTAGTGG - Intronic
1183823770 22:40369008-40369030 TCTACTTCCTTCTCTGCTATGGG + Intronic
949112075 3:273190-273212 TGTGCATTCTTCAGTGTTGTTGG + Intronic
952131368 3:30367389-30367411 TGTACATGCTTCTTTGCCATTGG + Intergenic
952389667 3:32869407-32869429 CTTACATTCTTCACTGATAGGGG + Intronic
953267594 3:41407440-41407462 TGTATATTCTTAAGGGCTATTGG - Intronic
958810448 3:98855061-98855083 TGTATCTTCTCCATTGCTATGGG - Intronic
960944761 3:122958378-122958400 TACACATTCTTCCCTGCTCTTGG - Intronic
963952230 3:151215589-151215611 TGTATATTCTTCACTGATGTCGG + Intronic
964510360 3:157443364-157443386 TGTCCATTGTTCATTGTTATTGG + Exonic
964941905 3:162168381-162168403 TGTACATTATTCATGGCTAAAGG - Intergenic
965815472 3:172631966-172631988 TGTAAAGTCTTCACTGCCAGTGG - Exonic
966295436 3:178415618-178415640 TGTACCATCTTCACTACTCTTGG + Intergenic
970351339 4:15204615-15204637 TATACATTCTTCTGTTCTATGGG + Intergenic
971431752 4:26575465-26575487 TGTGCATTCTTCACATCTCTGGG - Intergenic
971770852 4:30895176-30895198 TTTGCATTCTCCACTGCTATGGG - Intronic
976667649 4:87614056-87614078 ATTAGATTCATCACTGCTATTGG - Exonic
977970463 4:103207538-103207560 TGGACATTTTTCAGTGCTTTGGG + Intergenic
978440483 4:108728722-108728744 TGTATTTTCTTCTTTGCTATGGG + Intergenic
980464970 4:133162992-133163014 TTTACATTCCTCAGTGCAATTGG - Exonic
981950441 4:150400091-150400113 TGTACATTGTTCAGTGTTACTGG + Intronic
982519741 4:156399493-156399515 TTTACTTTCTTGACTGCTAAGGG + Intergenic
985902152 5:2805066-2805088 TGAATATTCTTCCCTGCTACAGG + Intergenic
990840204 5:60070619-60070641 TGTTCATTCTTCAGGGATATTGG + Intronic
991072659 5:62501954-62501976 TGGACTGCCTTCACTGCTATGGG + Intronic
993282142 5:85938659-85938681 TGTTCATTCTTCACTGCCATTGG - Intergenic
994821499 5:104656734-104656756 TCTACATTCTTCAGAGATATTGG - Intergenic
997019614 5:129983558-129983580 TTTTCATTCTTCTCTGATATGGG + Intronic
1000929924 5:167239356-167239378 TATACATTCTTCATTTCTCTGGG + Intergenic
1001251812 5:170152604-170152626 TGTACATCCCTCACTGCAAGGGG - Intergenic
1003543124 6:7035560-7035582 TGTACACTCTTAACTGGTATGGG + Intergenic
1004153641 6:13146686-13146708 TTTCCATTCTTCAGTGCTTTGGG + Intronic
1004279548 6:14269280-14269302 GGTTTATTCTTCACTGCTGTTGG - Intergenic
1004892854 6:20118079-20118101 TCTACATTCGTCACTGAAATAGG + Intronic
1008635810 6:53409608-53409630 TTCACATTCTTGAATGCTATAGG + Intergenic
1009912429 6:69947829-69947851 TGCAAATTCTTTACTCCTATAGG + Intronic
1010188787 6:73173246-73173268 AGTACAATCTTCACTCCTAAAGG - Intronic
1010778229 6:79910877-79910899 TGTAAGCTCTTCAGTGCTATAGG + Intergenic
1011884023 6:92070349-92070371 TGTTCATTTTTCTCTTCTATTGG - Intergenic
1013670098 6:112392271-112392293 TCCACATACTTCACTGATATTGG - Intergenic
1015096495 6:129419903-129419925 TGTACATTTTTAAGTACTATAGG - Intronic
1016766693 6:147802454-147802476 TGTACCATTTTCACTCCTATGGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017738818 6:157386521-157386543 TGTACTGTCTTCACTGTTCTGGG - Intronic
1018348660 6:162931002-162931024 TATACGTTCTTCAGTGATATGGG + Intronic
1020768987 7:12363455-12363477 TGTAGAGTCTTGACTGCTTTGGG + Intronic
1022344750 7:29503363-29503385 GGTTCATTGTTCACTGCTAGGGG + Intronic
1024231169 7:47364802-47364824 TGTCCATTCATCACTGCTCATGG + Intronic
1025707184 7:63876912-63876934 TGCACATTCTTCACTATTGTAGG - Intergenic
1026369522 7:69684588-69684610 TGTAAATTCATCACTGGTCTGGG - Intronic
1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG + Intronic
1030821918 7:114103606-114103628 TGTTCTTTCTTCCTTGCTATGGG + Intronic
1032825054 7:135560373-135560395 TGTACACTCTTTGCTGCTGTTGG - Intronic
1037520894 8:19679871-19679893 TGCACATTCCTCACTTTTATAGG - Intronic
1037931676 8:22884439-22884461 TGTGCATTCTTCTCTCCTAGTGG + Intronic
1038003398 8:23409602-23409624 TGTACACTGTACACTGCTGTGGG - Intronic
1042596619 8:70455324-70455346 TGTTCTTTCTTCCCTCCTATCGG + Intergenic
1042771554 8:72388202-72388224 TTTACAGTTTTCCCTGCTATTGG - Intergenic
1044144479 8:88694294-88694316 TGTACCTTCATCAGTGATATTGG + Intergenic
1044494477 8:92860415-92860437 TGTACATTTTACACTGCTAAGGG - Intergenic
1048621676 8:136140423-136140445 AGTACATACTTCACTGATCTGGG + Intergenic
1050208369 9:3223850-3223872 TGTACATTCTTCAATGGCAATGG + Exonic
1050481709 9:6094823-6094845 TCTACATTCATCACAGATATTGG + Intergenic
1052135376 9:24903070-24903092 TCTACATACTTCACTCCTCTAGG - Intergenic
1057933416 9:99215784-99215806 TGTCCATTCTTCAAGGCCATGGG + Intergenic
1187314295 X:18177994-18178016 TCAACATTCTTCACTTCTACTGG + Intronic
1193849024 X:86512755-86512777 TGAACATTTTTCAGTGATATTGG + Intronic
1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG + Intergenic
1197155014 X:123261015-123261037 TGCACATCCTTGACTGCTTTGGG + Intronic
1198127468 X:133660163-133660185 AGTATATTTTTCACTGCAATTGG - Intronic
1198530569 X:137547179-137547201 TGTACATTCTTCACAGTAACTGG - Intergenic
1198734060 X:139767002-139767024 TGTACATTCTGCACTCCTGTTGG - Intronic