ID: 1028454940

View in Genome Browser
Species Human (GRCh38)
Location 7:91028051-91028073
Sequence CTGGAGACTCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 956
Summary {0: 1, 1: 16, 2: 52, 3: 180, 4: 707}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028454940 Original CRISPR CTGGAGACTCAGAAGCAGGA AGG (reversed) Intronic
900173972 1:1283991-1284013 CTGGCAGCTCTGAAGCAGGATGG - Exonic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
901036273 1:6338169-6338191 CTGGGCCCTCACAAGCAGGAAGG + Intronic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
902631662 1:17708271-17708293 CTAGAGGCTCAGATCCAGGAGGG - Intergenic
902729449 1:18359610-18359632 CTAGAGGCTCAGAACCAGGCAGG - Intronic
902955915 1:19924007-19924029 GTGGAAACTCTGAAACAGGACGG - Intergenic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
905175130 1:36130637-36130659 CTGGCAACTCAAAAGAAGGAGGG - Intergenic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905872698 1:41414314-41414336 CTGCAGCCCCAGGAGCAGGAGGG + Intergenic
906165251 1:43681281-43681303 AAGGAGACTCAGAAGCAGACAGG - Intronic
906707346 1:47904328-47904350 CTGGGGGCTGAGAAGCAGGCAGG + Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906776541 1:48534941-48534963 CTAGAGCCTAAGAGGCAGGAAGG - Intronic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909041367 1:70656264-70656286 GTGGAGACGAAGTAGCAGGAAGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911072023 1:93839551-93839573 CTTCTGACTCAGAAGAAGGAAGG + Intronic
911156388 1:94641748-94641770 CTGGTGAGTCAGAAGCACCATGG - Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912555858 1:110515569-110515591 CTGGAGATTCAGGAGCACCATGG - Intergenic
913057288 1:115174352-115174374 CTGGAAACTCACAAAAAGGAGGG + Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914505052 1:148281562-148281584 CGTGAGGCTCAGAAACAGGAGGG - Intergenic
914507512 1:148302586-148302608 CGTGAGGCTCAGAAACAGGAGGG + Intergenic
914949395 1:152099139-152099161 CTGAAAACTCAGAAGCAGGGAGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915243835 1:154542585-154542607 CTAGAGACTGAGAAGTTGGAGGG + Intronic
915356067 1:155255684-155255706 CTGGAGCCTGAAAAGCTGGATGG - Intergenic
915504174 1:156342254-156342276 CTGATGACTCTGGAGCAGGAGGG + Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916280956 1:163050776-163050798 CTGGTGACTCAGTAGCTTGAAGG + Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917505317 1:175622192-175622214 TTGGAGACTCTGAATCTGGAAGG + Intronic
917579646 1:176362582-176362604 CTGGACACCCAGCAGCAGTAAGG - Intergenic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918829126 1:189369154-189369176 CAATAGACTCAAAAGCAGGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919795234 1:201317692-201317714 CTGGAGACCCGGAGGCAGAATGG + Exonic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920846335 1:209595912-209595934 CTGCAGACTCTGACGCAGGCTGG + Intronic
922171566 1:223159866-223159888 CTGGAACCTCTGGAGCAGGAAGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922484033 1:225959402-225959424 AAGGCCACTCAGAAGCAGGAAGG - Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
922995053 1:229950307-229950329 GTAGAGACTCAGAAGCGGGAGGG - Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923888192 1:238181065-238181087 CTTCAGCCTCAGTAGCAGGAAGG + Intergenic
924023587 1:239810241-239810263 CTGGGGAATCCGAAGCAGCAAGG - Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1062790871 10:305412-305434 CTTGAGACTTAGCAGCAGAATGG - Intronic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064193907 10:13230198-13230220 CTAGGGAGTCTGAAGCAGGAGGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065125501 10:22569713-22569735 CCTGAGAATCAGAAGCAGGGTGG - Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1065484893 10:26228046-26228068 CTGGTGGCTGAGGAGCAGGAGGG - Intronic
1065698434 10:28401740-28401762 CATGAGAGTCAGAACCAGGATGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066571554 10:36778607-36778629 CTGCAGGGTCAGAAGCAGAATGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066995261 10:42556833-42556855 TTGAAGTCTTAGAAGCAGGAAGG - Intergenic
1066995704 10:42561032-42561054 CTGGAGACTGAGATGCTGCAGGG - Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067650505 10:48150598-48150620 CTGGAGATTCTGAATCAGTAGGG - Intergenic
1067766979 10:49094196-49094218 CTGGAGCCTCAGAAGCAGTGGGG + Intronic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068465639 10:57387166-57387188 ATGGAGACTCAGAAGCCCAAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069927444 10:71860578-71860600 CTGGTGAGTCAGCAGCAGCAGGG + Intergenic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1070707063 10:78647514-78647536 CAGCAGACTCAGAAGATGGAAGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071629652 10:87208042-87208064 CTGGAGTCTTAGAAGAAGGGAGG + Intergenic
1072188395 10:93062467-93062489 CTGGAGACTCAGACCTAGAAAGG + Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075877498 10:125820250-125820272 CTGGAGACTTGTTAGCAGGAAGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076388088 10:130073642-130073664 CTTGAGTCTCTGCAGCAGGAGGG + Intergenic
1076854618 10:133109693-133109715 CTGGAGAATATGAACCAGGAGGG - Intronic
1077439828 11:2562624-2562646 CTGGAGACTCTGAAGAGGGGTGG - Intronic
1078260574 11:9703407-9703429 CTGAAGGCTCTGAGGCAGGAAGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079261922 11:18890766-18890788 CAGGAGACTGGAAAGCAGGAGGG + Intergenic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081887750 11:46513716-46513738 ATGGAGACTGACAAACAGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1082834296 11:57640295-57640317 CTGGAGGCTCAGACCCAGGCAGG - Intergenic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1084117570 11:67050902-67050924 CTGGGCACTCTGTAGCAGGAAGG - Intergenic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085715909 11:78873091-78873113 CTGGAGACTGGGAAGCTGTAGGG - Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1087241804 11:95789475-95789497 GAGGAGACTGAGGAGCAGGATGG - Exonic
1088615127 11:111618553-111618575 CTGGGGAGGCTGAAGCAGGAGGG + Intronic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089549099 11:119256722-119256744 TTAGAGACTCAGAAGCGGGGAGG - Intronic
1089647692 11:119890902-119890924 CAGGAGACCAAGAAGCAGGTGGG + Intergenic
1090037664 11:123262948-123262970 CCAGAGACTCAGAGGCAGGCAGG + Intergenic
1090168463 11:124576996-124577018 GTAGAGACTCATAGGCAGGAAGG + Intergenic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1090860822 11:130650963-130650985 CTGTGGACTCAGAATTAGGATGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091006785 11:131960870-131960892 CTGAAGATTCAGGTGCAGGAGGG + Intronic
1091358583 11:134957218-134957240 CTGGAGACTAAGAAGCCCCATGG + Intergenic
1091448381 12:557858-557880 TTGGAGACTAGGAATCAGGAAGG - Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1091918882 12:4288753-4288775 GCAGAGACTCAGAAACAGGACGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093628641 12:21382316-21382338 TTAGAGATTCAGAAGCGGGAGGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094281332 12:28743006-28743028 CTGGAGTCACAGAAGCATGGAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1095435739 12:42185956-42185978 CTGGGGAGTCCGAAGCAGGTGGG + Intronic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096466562 12:51849960-51849982 CTGGAGGCTCAACAGCAGGAAGG - Intergenic
1097234069 12:57527995-57528017 CTGGAGACTCTGTAGCAGGCAGG - Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097988445 12:65808931-65808953 CTGGAAACTGAGAAAGAGGATGG - Intergenic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099473296 12:83076773-83076795 AGGGAGAATTAGAAGCAGGAGGG - Intronic
1099568760 12:84286028-84286050 CTGGAGACTCTTACCCAGGAAGG - Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101392385 12:104313691-104313713 ATCAAGACTCAGAAGCAGCAAGG - Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101630452 12:106488110-106488132 CTGTGGGCTCAGAAGCAGGCAGG + Intronic
1101782741 12:107850029-107850051 CTGGAGAATCTGGGGCAGGAGGG - Intergenic
1101928713 12:108994693-108994715 CTGGAGACTCTGAAGTCAGATGG - Intronic
1101946625 12:109142139-109142161 CTTGAGAGGCTGAAGCAGGAGGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102897308 12:116608953-116608975 CTGGAGACTCAGAAGCGGGGCGG + Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103179038 12:118891709-118891731 CTGAAGACTAGGAAGGAGGATGG + Intergenic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103668263 12:122589576-122589598 CAGGAGGCTGAGCAGCAGGAGGG - Intronic
1103881953 12:124172922-124172944 ATGGAGACTCTGAAGCCCGAAGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1104942047 12:132399767-132399789 CTGGAGACTCAGGCGTTGGAGGG - Intergenic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105592263 13:21803604-21803626 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106104350 13:26721389-26721411 CAGGAGGCTTAGAGGCAGGAGGG + Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1107344818 13:39447837-39447859 CTGGAAAGTGAGAAACAGGAAGG + Intronic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107773535 13:43813449-43813471 ATGGAGACTCAGAGGCTGGGTGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110555086 13:76850779-76850801 CTGGAAACTCAGTCCCAGGAAGG - Intergenic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1111823054 13:93236388-93236410 CCGGAGACTAAGAAGTAGGGAGG - Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113702816 13:112399680-112399702 CTGGAGATTCAAAACCAGAAAGG + Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113801570 13:113089270-113089292 GTGGCCCCTCAGAAGCAGGAGGG + Intronic
1113801584 13:113089340-113089362 GTGGCCCCTCAGAAGCAGGAGGG + Intronic
1113801599 13:113089410-113089432 GTGGCCCCTCAGAAGCAGGAGGG + Intronic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114648809 14:24270325-24270347 CTGGAGACTCAGAAGTGCGTAGG - Exonic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116950692 14:50875939-50875961 CTGGAGACTAACAGGCAGGGTGG + Intronic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118622886 14:67630409-67630431 TTGTAGCCTCAGCAGCAGGATGG + Intronic
1119543689 14:75456906-75456928 CTGGGGACTCAGGACCAAGAGGG - Intronic
1121107502 14:91290705-91290727 CTGGAGTCACTCAAGCAGGATGG - Intronic
1121309434 14:92927433-92927455 CTGGAAACTCAAAACCAGGGTGG - Intronic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121739822 14:96243463-96243485 CTGGAGAGCCAGAACCTGGAGGG + Exonic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122318540 14:100839742-100839764 CTGCAGACACTGCAGCAGGAGGG + Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123448172 15:20344532-20344554 CTGGAGACTAAGGAGAAGCAAGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1123807810 15:23893186-23893208 CAGGAGACACAAAAGCAAGAAGG + Intergenic
1123945948 15:25238958-25238980 CTTGAGATTCAGTGGCAGGAAGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1125535814 15:40440904-40440926 CTGGGGACGAGGAAGCAGGAAGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127405609 15:58641916-58641938 CAAGAGGCTCAGAAGCAGGGAGG + Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127889645 15:63238302-63238324 CTGGAGACTAGAAAGAAGGAGGG - Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128231452 15:66038354-66038376 ATGGAGGCTCAGAGGCAGGCAGG - Intronic
1128345441 15:66850007-66850029 CTGGAGGCTGAGGAGCAGGCTGG - Intergenic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1132250823 15:100334534-100334556 CCGGAGAGTCAGAGGCAGGACGG - Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1134216351 16:12319808-12319830 ATGGAGACTTCAAAGCAGGAAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134740667 16:16540914-16540936 CTGGAGACTCAGAAGAGGAGAGG - Intergenic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134926835 16:18171266-18171288 CTGGAGACTCAGAAGAGGAGAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135059001 16:19255141-19255163 TGGGAGACTCAGGAGCAGGTGGG - Intronic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137370831 16:47904304-47904326 CTGGACACACTGAAGCAGAAAGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138135128 16:54514855-54514877 CCGGAGACTTAGAAGGTGGATGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140478057 16:75248820-75248842 CGTGACACTCAGCAGCAGGAGGG + Intronic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1142005125 16:87686050-87686072 CTGGAGACTCCGTGGCTGGAGGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143410884 17:6707788-6707810 CTGGAGACTTAGAAGCAGACAGG + Intronic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144733075 17:17539957-17539979 CAGGAGGCTCGGGAGCAGGAGGG + Intronic
1144750373 17:17644389-17644411 CTGGTCACTCAGAACCAGGCAGG + Intergenic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146582354 17:34049953-34049975 CTGGAGACTCAGAAATAGTTGGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149462905 17:56847683-56847705 CTGGAAACTGAGGTGCAGGAAGG - Intronic
1149622629 17:58057495-58057517 CTGTAGGCTCAGGAACAGGAAGG + Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151391767 17:73791916-73791938 CTAGAGGCTCAGCAGCTGGAGGG + Intergenic
1151498565 17:74474298-74474320 CTGGACCCTCATCAGCAGGATGG + Intronic
1151702272 17:75749884-75749906 CTGGAGGAACAGAAGCGGGAGGG - Intronic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152232856 17:79123509-79123531 CCGGAGATTCAGCAGCAGGAGGG - Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152340623 17:79722048-79722070 CTGGAGACTAAGGAGAAGCAAGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1153347289 18:4041025-4041047 GTACAGACTCAGAAGCAGCAGGG + Intronic
1153350835 18:4079521-4079543 CTGGAGACTCAGAAGTGGGGAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154496365 18:14964000-14964022 CTGGAGACTAAGAAGCCCCATGG - Intergenic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1155252283 18:23964064-23964086 CTGGGGACTCAGAATCACCAGGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156161552 18:34365146-34365168 CCAGAGAGTCAGAATCAGGAGGG + Intergenic
1157115981 18:44863247-44863269 CTGGGGACTCTGAAACAGGCAGG - Intronic
1157394702 18:47331860-47331882 AAGCAGACTCAGAAGCTGGAAGG - Intergenic
1157814811 18:50722841-50722863 CTGGAGATTGAGAGGCAGGTGGG - Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158729181 18:60003803-60003825 CTGGAGACAGGGAAGCTGGACGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160394129 18:78559499-78559521 CCAGAGTCTCAGAAGCAGCATGG - Intergenic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161530176 19:4784106-4784128 GTGGAGACTCAGAAGCGGGGAGG + Intergenic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1163171247 19:15532746-15532768 TTGGAGTCTCAGAACCAGGCAGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163313232 19:16526265-16526287 CTGGAGACTTAAAGCCAGGAGGG + Intronic
1163557481 19:18000991-18001013 CTGTTGAATCAGAAGCAGGCAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164446399 19:28321267-28321289 GTGGAGATTCAAAAGCAGGAGGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164844739 19:31422338-31422360 CTGGAGAATCCCAAGCAGGTGGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165279890 19:34786813-34786835 CTAGGGCCTCAGAGGCAGGAAGG - Intergenic
1165331854 19:35144621-35144643 CTGCAGAATCCGAAGCAGGGCGG + Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167180385 19:47898684-47898706 CTGGAGTCTTATAAACAGGATGG - Intergenic
1167348730 19:48962445-48962467 CTGGCGACTGAGAGGCTGGAGGG + Intergenic
1167478300 19:49713350-49713372 CTGGAGGCTGAGAAACAAGAGGG - Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925205673 2:2003635-2003657 CTGAAGACTCAGGTACAGGAAGG - Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
926577544 2:14598706-14598728 CTGGAGACTCAGGAGATGGTAGG - Intergenic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927277012 2:21270973-21270995 CTGGAGGTGCAGAAGCTGGAGGG - Intergenic
927424198 2:22963088-22963110 CTGGAGAGTCCATAGCAGGATGG - Intergenic
927889763 2:26741019-26741041 CTGCAGCCTGAGCAGCAGGATGG - Intergenic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
928220427 2:29398691-29398713 CTGGAAACTGGGAAGGAGGAGGG - Intronic
928663941 2:33531633-33531655 CAGGAGACTGAGACTCAGGAAGG + Intronic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929323532 2:40577131-40577153 ATGCTGACTGAGAAGCAGGAAGG + Intronic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931018534 2:58014860-58014882 CTAAAGACCCAGAACCAGGAAGG + Intronic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
931997414 2:67852481-67852503 CTCGGGACTCAGAAACATGAGGG + Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935335530 2:102012309-102012331 CTGGAGACTCTGAAGCCAGCTGG - Intronic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
936273452 2:111070025-111070047 CTCAGGACTCAGAAGCAGCAGGG + Intronic
936316058 2:111425163-111425185 CTGGGGACTCAGGAGCAGCCTGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936461324 2:112715545-112715567 CTGGGGGCTCAGAAGAAGGTGGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937108340 2:119340269-119340291 GTGGAAACAGAGAAGCAGGACGG + Exonic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939158384 2:138554425-138554447 CTGGAGATTCTGTAGAAGGAAGG - Intronic
939489291 2:142857467-142857489 CTGGAGGCTGAGGAGGAGGATGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941887192 2:170540206-170540228 CTGCAGACTCCGAAGTAGGTGGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942912999 2:181268904-181268926 CTGAAGACTGATAACCAGGAGGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943341359 2:186685736-186685758 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
945043322 2:205760705-205760727 CTGGAGTTTCAGTAACAGGAAGG + Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946795897 2:223352419-223352441 ATAGAGACTCAGAAGCGAGAGGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947580627 2:231314859-231314881 CTGGATATTCATATGCAGGAGGG - Intronic
947702565 2:232246669-232246691 GTGCAGACTCAGCAGCAGCATGG - Intronic
948875951 2:240828522-240828544 CTAGAGACTCCGAAGCGAGAAGG + Intergenic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169170324 20:3459686-3459708 CTGGAGATTCAGGAGCCTGATGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170813724 20:19695703-19695725 CTGGAGACTGAAAAACAGGAAGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172234482 20:33361211-33361233 CGGGAGCCTGTGAAGCAGGAGGG + Intronic
1173021271 20:39269656-39269678 CTGCAGAGTCAAGAGCAGGAAGG - Intergenic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1174785887 20:53432128-53432150 CTGGAGACTCAGAAGTGGGGAGG - Intronic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175133915 20:56808907-56808929 CTGGAGGCTCAGGAGCAAGCAGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175787542 20:61721423-61721445 TTAGACACTGAGAAGCAGGAGGG - Intronic
1177378921 21:20312538-20312560 CTGGAGACTTAGAAGGTGGGAGG + Intergenic
1178699307 21:34819855-34819877 CTGGCGGGCCAGAAGCAGGATGG - Intronic
1178936064 21:36862814-36862836 CTGGAGACTCACCAAAAGGAAGG + Intronic
1178947259 21:36959031-36959053 CTGCCAACTCAGAAGCGGGAAGG - Intronic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1179318350 21:40267012-40267034 CGGGAGACTCAGAAGTGGGGAGG + Intronic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1180261792 21:46675242-46675264 TTGGAGGCTCTGAGGCAGGAGGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181041929 22:20196410-20196432 CTGGAGACGCAGGTGCAGGTGGG - Intergenic
1181174448 22:21027822-21027844 CTGGAGATTGAGAGGCAGCAGGG - Exonic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181536443 22:23548738-23548760 CTGGGGCCTCAGAAGCAGACAGG + Intergenic
1182057485 22:27371217-27371239 CTGGGGAGTCAGACGCAGAAGGG + Intergenic
1182566773 22:31206002-31206024 CTGGAGACCCCAAAGCTGGAGGG + Exonic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184049337 22:41992586-41992608 CTGGACTTTCAGGAGCAGGATGG - Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184967918 22:47995217-47995239 CTGGAGCCCCAGCAGCTGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
949203278 3:1406778-1406800 CTGAAGGCTAAGAACCAGGAGGG + Intergenic
949944179 3:9177221-9177243 ATGGAGACTCCGTAACAGGAGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952272667 3:31847989-31848011 CAGGAGCCTCGGAGGCAGGAGGG - Intronic
952329977 3:32355867-32355889 CTAGCGAGACAGAAGCAGGAAGG - Intronic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
952729121 3:36620536-36620558 CTGGAAAGTCAGGAGCAGAAAGG - Intergenic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956737343 3:72247828-72247850 CTGGAGACTGAACAGCTGGATGG + Intergenic
956738418 3:72256469-72256491 CTGGACCCTCTCAAGCAGGATGG + Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
957121121 3:76094293-76094315 CTTAATCCTCAGAAGCAGGAAGG + Intronic
958435225 3:94088043-94088065 CTAGAGATGAAGAAGCAGGAAGG - Intronic
958665176 3:97128014-97128036 CCGGAGACTCAGAAGTGGGGAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960079813 3:113529550-113529572 GTAGAGACTCAAAGGCAGGAAGG + Intergenic
960977090 3:123186016-123186038 CGGGAGGCTGAGAGGCAGGAGGG - Intronic
961199057 3:125029333-125029355 CTGGAGCATCCGAAGCAGCATGG + Exonic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
962174115 3:133134781-133134803 CTACAGACTCAGAAGCGGGGAGG - Intronic
962226945 3:133620928-133620950 CATGAGAGTCAGAAGCAGGCAGG - Intronic
962937042 3:140090773-140090795 ATCAAGACTCAGAAGCAGGCTGG + Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965681570 3:171257174-171257196 CTAGAGACTTAGAAGAAGCAAGG + Intronic
965824325 3:172715603-172715625 CTGGAGCATCAGATGCAGGGAGG + Intergenic
966499305 3:180620921-180620943 CGGAAGACTCAGAAGCATGGTGG - Intronic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
968953971 4:3708843-3708865 CTGGGGTCTCAAAACCAGGATGG + Intergenic
968954969 4:3713616-3713638 CTGGAGACTTAAACCCAGGAGGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969172441 4:5375111-5375133 CTGGAGTTTCAGAAGCCAGATGG - Intronic
969187326 4:5486186-5486208 GTGGAGTCTCAGAGGCAGGCTGG + Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978690862 4:111507607-111507629 CTGATGACCCAGAAGTAGGAGGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980808033 4:137838278-137838300 CTGGGGACTAAGAAGCCAGATGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983555993 4:169059685-169059707 CTTGACAGTCAGAAGCAGGCAGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985655118 5:1127424-1127446 CTGGAGCCGCAGAAGTTGGAAGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986263141 5:6166653-6166675 CTGGAGAGTGAGAGGTAGGAAGG - Intergenic
986395713 5:7327639-7327661 CTGGTGACTGAGAAGCACTAGGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986737539 5:10679406-10679428 CTGAAGACTGAGAAGCATTAAGG + Exonic
986944453 5:12998875-12998897 CTGGATGCTCAGAAGCCAGAGGG - Intergenic
987224993 5:15830959-15830981 CTGGAGAGTCTCAAGCAGCAAGG + Intronic
987625555 5:20395428-20395450 CTGGAGACTCAGAAATAGAGAGG + Intronic
987659226 5:20850924-20850946 CTAGAGACTCAGAAGCGAGGAGG + Intergenic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988764444 5:34355057-34355079 CTAGAGACTCAGAAGCGAGGAGG - Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989464485 5:41739168-41739190 CTTAGGACTCAGAAGCAGGAAGG - Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
990979296 5:61587340-61587362 TTGGTGACTCAGATGCAAGACGG + Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991527919 5:67583343-67583365 CTGGGGAGGCTGAAGCAGGAAGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997294678 5:132762096-132762118 CTGGAGAATCAGGAGCACCAGGG - Intronic
997354218 5:133252036-133252058 CTGGACACTCAGAAGCCAGCCGG + Intronic
997636730 5:135414476-135414498 TCGAAGACTCAGAAGCAGGGAGG + Intergenic
998533653 5:142908872-142908894 GAGGAGACTCACAAGCAGGCAGG - Intronic
998934058 5:147215760-147215782 ATTGAGACTCAGGAGCATGAAGG - Intergenic
999196536 5:149785177-149785199 CTGGAGACTGAGGCCCAGGAGGG - Intronic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000755759 5:165157562-165157584 GTGGAGACTGAGAAGTAGAAGGG - Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001133459 5:169083116-169083138 CTGGTCACTCAGAAGCGGAATGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002432492 5:179211587-179211609 CTAGAGACTCTAAAACAGGATGG - Intronic
1002770935 6:290673-290695 CAGGTGACTGAGAAGCAGGCGGG + Intergenic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003625607 6:7738522-7738544 CTGGTGGCACAGAAGCGGGAGGG - Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003982604 6:11403558-11403580 CTGGACCCTGGGAAGCAGGAGGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005514022 6:26537642-26537664 TGGAAGACTCAGAAGCAAGAGGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006516628 6:34549202-34549224 CTGGGGCCTCTGGAGCAGGAGGG - Intronic
1006525482 6:34601105-34601127 CTGGAGGCTGGGAAGCAGGGAGG + Intronic
1006664343 6:35679758-35679780 CTAGAGACTCAGAAGAGGGCAGG + Intronic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1008487936 6:52055497-52055519 CTGAAAACTCAGAAGCACAAAGG - Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1009925931 6:70120712-70120734 ATGGATACTTAGAAGCAGGCTGG - Intronic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011402787 6:86982040-86982062 CTGGAGAATAAGAACCAGGTGGG + Intronic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1012029560 6:94041066-94041088 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1012137769 6:95579698-95579720 CAAGAGATTCAGAAGCAGGGTGG - Intronic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013847534 6:114471938-114471960 CTGGAGAGACAGAAGCTGGTAGG - Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015607757 6:134976738-134976760 CTGGAGACTCAGTAGCGGGTAGG + Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015869429 6:137760960-137760982 CTGGTGAATCTGAAACAGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1018652033 6:165999994-166000016 CTGGAGACTGAGAGCAAGGAGGG - Intergenic
1018935120 6:168269201-168269223 CTGGTGACTGCGATGCAGGAAGG + Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019776591 7:2915236-2915258 CTCTTGACTGAGAAGCAGGAAGG - Exonic
1020061000 7:5152201-5152223 GTGGAGACCTGGAAGCAGGATGG - Intergenic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022354165 7:29596281-29596303 CTGAAGACTCAGAAGTGGGGAGG + Intergenic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024960567 7:54970636-54970658 CTGGAGACTCCTCAGCAGGAGGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026587558 7:71668738-71668760 CTGCAGACTCAGCTGCAAGATGG - Intronic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027867028 7:83661176-83661198 CAGGAAACTTACAAGCAGGATGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029572500 7:101379481-101379503 CTGGAGGGTGAGAGGCAGGAAGG - Intronic
1030145755 7:106353161-106353183 CTGGAGACTCAGAAGTGGGGAGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030482046 7:110116584-110116606 TTTGAGAGTCTGAAGCAGGAGGG + Intergenic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031978530 7:128108824-128108846 CATGGGACTCAGTAGCAGGAAGG + Intergenic
1032017534 7:128389428-128389450 CTGGAGCCACAGAAGCTGAAAGG + Intergenic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035582708 8:749919-749941 GTGGAGACAGAGAAGCAGGCTGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037586869 8:20283016-20283038 CTGGGGGCTCAGAAGTGGGATGG + Intronic
1037856404 8:22374351-22374373 GTGGAAAGTCAGATGCAGGATGG + Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038908017 8:31928854-31928876 TTGGAGACTAAGAAGCGGGGAGG + Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1039781994 8:40794957-40794979 CTGGAAGCTCAGAAGAGGGAGGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041197595 8:55416623-55416645 CTGGAGGATCACAAGCAGGGGGG + Intronic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041341611 8:56852137-56852159 ATGGAGACTGGGCAGCAGGAAGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1041967202 8:63692719-63692741 CACGATAGTCAGAAGCAGGATGG - Intergenic
1042141184 8:65680269-65680291 CAGGAGAGTCTAAAGCAGGAAGG - Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043074665 8:75683186-75683208 TTGGAGAGTCAGAAGCGGGGAGG - Intergenic
1043091751 8:75913126-75913148 CTGTAGACTCTGTATCAGGAAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043765813 8:84130854-84130876 CTGTAGACTCAAAAATAGGATGG + Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044879529 8:96709252-96709274 TTGGAGACTCAGAAGCGGAGAGG - Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1045988476 8:108278072-108278094 CTGGATACCCAGTAGTAGGATGG - Intronic
1046198968 8:110897102-110897124 ATAGAGACTCAGTAGCAGGCAGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047504369 8:125467100-125467122 CCGTGGTCTCAGAAGCAGGAAGG - Intergenic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049230889 8:141480573-141480595 CTGGGGACTCAAAAGAAGGGAGG - Intergenic
1049801512 8:144519889-144519911 CTGGAAACTGAGCAGCGGGAAGG - Exonic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1052061726 9:23967732-23967754 CTGGAGACTCAGAGGATGGGAGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052599408 9:30605285-30605307 CTGGAGACTGAGAAGCAGGGAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052975182 9:34405001-34405023 CTGGAGCCTGAGGAGGAGGATGG + Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053681517 9:40488796-40488818 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054282196 9:63136138-63136160 TTGGAGCCTCGGAGGCAGGAGGG + Intergenic
1054294608 9:63324313-63324335 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054392630 9:64628800-64628822 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054427278 9:65134009-65134031 TTGGAGCCTCGGAGGCAGGAGGG - Intergenic
1054503098 9:65887531-65887553 TTGGAGCCTCGGAGGCAGGAGGG + Intronic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1056720248 9:89065071-89065093 CTGAAGACTTAGAAGCTGAAAGG + Intronic
1057132096 9:92661383-92661405 CTGGTGACTCAGTAGCAGCGAGG - Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057479290 9:95431991-95432013 CTAGAAATTCAGAGGCAGGAAGG - Intergenic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1058261190 9:102834657-102834679 CTTGAGAGTCAGAAACAGGAGGG - Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058810369 9:108633270-108633292 CTTGAGAGGCTGAAGCAGGAAGG + Intergenic
1059377732 9:113898983-113899005 CTGGAGACTCTGAGGCAGGCTGG - Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1061126865 9:128682641-128682663 CTTGAGCCTCAGAGACAGGATGG + Intergenic
1061981899 9:134110154-134110176 GTGGTGACTCAGCAGCAGAATGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185985973 X:4834112-4834134 TCAGAGACTCAGAAGCGGGAGGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188208509 X:27389947-27389969 GTGGAGACTCAAAGGCAGGCAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1191875182 X:65788348-65788370 CAGCTGACTCAGAAGCAAGACGG + Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192215943 X:69158235-69158257 CTGGAGAATCAGAAACTGGCAGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193222977 X:78948620-78948642 CTAGAGACTCAGAAGAGGGTGGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195520385 X:105822566-105822588 CTGGAGACGAAGAAGCTAGAAGG - Exonic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198445148 X:136705996-136706018 TTGGAGACTAAGATGCAGAATGG - Intronic
1198633543 X:138669907-138669929 CTGAAGTGTCAGAAGCAGAAAGG + Intronic
1198803597 X:140472104-140472126 CTTGAGAGGCTGAAGCAGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200794309 Y:7326496-7326518 CTGGAGACTCAGAAGTGGGGAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1200987288 Y:9316178-9316200 CTGAGGACTCAGAAGTTGGATGG + Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1202118296 Y:21496470-21496492 CTGAGGTCTCAGAAGCTGGACGG - Intergenic
1202120748 Y:21520010-21520032 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202123199 Y:21543551-21543573 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202155807 Y:21885830-21885852 CTGAGGTCTCAGAAGCTGGACGG + Intronic
1202158255 Y:21909371-21909393 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202184708 Y:22174296-22174318 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202198139 Y:22317435-22317457 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202206652 Y:22412105-22412127 CTGAGGTCTCAGAAGCTGGATGG - Intronic