ID: 1028455164

View in Genome Browser
Species Human (GRCh38)
Location 7:91030630-91030652
Sequence GCAAGCCTGTCACCTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028455161_1028455164 21 Left 1028455161 7:91030586-91030608 CCCTGTGAAAGAGGAGGTAAGAC 0: 1
1: 0
2: 3
3: 15
4: 230
Right 1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 107
1028455160_1028455164 22 Left 1028455160 7:91030585-91030607 CCCCTGTGAAAGAGGAGGTAAGA 0: 1
1: 0
2: 2
3: 25
4: 260
Right 1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 107
1028455162_1028455164 20 Left 1028455162 7:91030587-91030609 CCTGTGAAAGAGGAGGTAAGACT 0: 1
1: 0
2: 0
3: 20
4: 197
Right 1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG 0: 1
1: 0
2: 1
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028455164 Original CRISPR GCAAGCCTGTCACCTGGTAG AGG Intronic
901054686 1:6443705-6443727 GCAGGCCTGGCACCAGGTAACGG - Intronic
902479672 1:16704899-16704921 GCAGGCCTGGCACCAGGTAACGG + Intergenic
903013305 1:20345466-20345488 GCAAGGCGCTCACTTGGTAGCGG - Exonic
903538203 1:24081317-24081339 GCAGGCCTCTCACCTGGCTGGGG + Exonic
905013087 1:34760098-34760120 GCCAGGCTGTCAGCTGCTAGAGG - Intronic
905031454 1:34886547-34886569 GCCAGCCAGACACCTGGAAGAGG - Intronic
905541408 1:38763251-38763273 AGAAGCCAGTCTCCTGGTAGAGG + Intergenic
905693164 1:39957155-39957177 CACAGCCCGTCACCTGGTAGGGG - Exonic
907008913 1:50944424-50944446 GCAATCCTGACACTTGGTGGAGG - Intronic
908386198 1:63644020-63644042 TCAGGCCTGTCACCTGGCAGGGG + Intronic
919147641 1:193655560-193655582 GCAAGCCTGACACCTGGGTGTGG + Intergenic
920771131 1:208886718-208886740 CCATGCCTGACACCTTGTAGAGG + Intergenic
924052837 1:240093810-240093832 GGAAGGCGGTGACCTGGTAGTGG + Intronic
1067274626 10:44822766-44822788 CCAAGCATGTCACCTGGGATGGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070272907 10:74975439-74975461 GGAAGGGGGTCACCTGGTAGGGG + Exonic
1071905470 10:90169207-90169229 GCAATCCTCACACCTGGTTGCGG + Intergenic
1073004854 10:100315429-100315451 CCAGGCCTGTCACGGGGTAGGGG - Intronic
1073042023 10:100614386-100614408 GCCAGCCTGGTACCTGGTACTGG - Intergenic
1074862148 10:117518550-117518572 GAAAGGCTGCCACCAGGTAGAGG - Intergenic
1075906289 10:126084572-126084594 GCAAGCCTGTAACAGGATAGAGG + Intronic
1081657637 11:44868043-44868065 GCCAGCCTGTCACCAGCTGGAGG - Intronic
1083268932 11:61560989-61561011 GGAGGCCTGTCATGTGGTAGAGG - Intronic
1085575065 11:77595467-77595489 CAAAGCTTGTCATCTGGTAGAGG - Intronic
1087152760 11:94873144-94873166 GCAAGTCTGACACCTGATTGGGG - Exonic
1093049399 12:14489051-14489073 GCAAGCACCTCATCTGGTAGTGG + Intronic
1099978488 12:89571234-89571256 GCAAGTCTGACACCTGTAAGAGG - Intergenic
1104556756 12:129807231-129807253 ACAAGCCTGTCCCCAGGGAGCGG + Intronic
1107859608 13:44648280-44648302 TCAAGCCTGGCATCTGGGAGAGG - Intergenic
1113470582 13:110542357-110542379 TCAAGCCTATCACATGGTACTGG + Intronic
1113875633 13:113592931-113592953 GCACGCCTGTCACCTGGGCAGGG - Intronic
1117790087 14:59331314-59331336 GGAAGCATCCCACCTGGTAGAGG - Exonic
1119059439 14:71460260-71460282 GCAAGCATGTCAGCGGGTCGTGG + Intronic
1119741020 14:77013872-77013894 GCAAGGCTGGGACCAGGTAGGGG + Intergenic
1121709325 14:96025762-96025784 GTAAGCCTGGCACCTTATAGTGG - Intergenic
1123943649 15:25228594-25228616 GCAAGCGTGTCACCTGGCTCGGG - Intergenic
1128649414 15:69399797-69399819 TCAGGTCTGTGACCTGGTAGAGG - Intronic
1134089741 16:11385101-11385123 TCAAGCTTGTCACCTGGCTGTGG - Intronic
1134762328 16:16725220-16725242 ACAAGGCTGTCATCTGGAAGTGG - Intergenic
1134983731 16:18633950-18633972 ACAAGGCTGTCATCTGGAAGTGG + Intergenic
1137775760 16:51053196-51053218 TCAAGCCTGTAAACTGATAGAGG - Intergenic
1139993034 16:70955097-70955119 GGAAGTCTGACACCTGGTGGGGG - Intronic
1140838658 16:78818721-78818743 GCAAGCTAGTTACATGGTAGAGG - Intronic
1141429683 16:83965227-83965249 GGAAGCCGCTCACCTGGAAGAGG - Exonic
1144637958 17:16923068-16923090 GCAAGTCTGTGTCCAGGTAGGGG + Intergenic
1144742845 17:17593726-17593748 GCAAGTCTGTCTCCTGGGTGGGG - Intergenic
1144955556 17:19017234-19017256 GCCAGCCTGACACCTGGCACGGG - Intronic
1146001790 17:29134857-29134879 GCAGGCCTGTGACCTAGGAGAGG + Intronic
1146638214 17:34521513-34521535 GCATGCCTGGCACTTGGAAGGGG + Intergenic
1151338191 17:73452775-73452797 GCAAGCCAATCAATTGGTAGTGG - Intronic
1152086075 17:78219567-78219589 GAGAGCTTGTCACCTGGTTGAGG + Intronic
1158407804 18:57175857-57175879 GAAAGCCTGTCCCCTGGGAGTGG + Intergenic
1158594823 18:58806981-58807003 GCAAACTCGTCCCCTGGTAGTGG + Intergenic
1160431693 18:78817246-78817268 GAACGCCTGTCACCTGGAGGAGG - Intergenic
1160679559 19:406536-406558 CCAAGCCTGACCCCTGGGAGGGG + Exonic
1161442881 19:4302409-4302431 GGAAGTCTGTCAACTGGGAGGGG - Exonic
1161807687 19:6454504-6454526 CCAGGCCTGACACCTGGGAGGGG - Intronic
1162077099 19:8195306-8195328 GCAAGGCAGACACCTGGTTGGGG - Intronic
1164541142 19:29122379-29122401 GCAGTCCTGTCTCCTGGTGGGGG - Intergenic
1167314449 19:48755545-48755567 GGAAGCCTCTCACCTGGCCGTGG - Exonic
1202713708 1_KI270714v1_random:30805-30827 GCAGGCCTGGCACCAGGTAACGG + Intergenic
927602225 2:24453929-24453951 GGAAGCCTGAAATCTGGTAGGGG - Intergenic
929953072 2:46431654-46431676 GCAGGGCAGGCACCTGGTAGAGG + Intronic
931349993 2:61479139-61479161 GCAAACCTGTTAACTGGTGGGGG + Intronic
932764495 2:74461376-74461398 GAAAGCCTGTAGCCTGGTACTGG + Exonic
933764244 2:85696105-85696127 GCCAGCCTGTGACCAGGTCGGGG + Intronic
934717861 2:96553666-96553688 GCATGCCTGGCACCAGGGAGTGG + Intergenic
936091639 2:109505216-109505238 GCCAGCCTGACACCTGGCAGAGG + Intergenic
937864019 2:126734610-126734632 GCAAGCATGCCACCTGGAAGTGG - Intergenic
937874211 2:126809130-126809152 GCTGGCCTGTCTCCTGATAGAGG + Intergenic
939103097 2:137918342-137918364 GCAAGACTGTCACCTGAGTGTGG + Intergenic
944812193 2:203338507-203338529 GCCAGCATGTCACATGGTGGGGG - Intronic
947847923 2:233260530-233260552 GAAAGCAGGTCACCTGTTAGTGG + Intronic
948903688 2:240968069-240968091 GCCTGCCTGTGACCTGGGAGGGG + Intronic
1170361668 20:15553170-15553192 GAAAGCCTGGCACCTAGTAGGGG - Intronic
1172826926 20:37796820-37796842 ACATGCCTGTCTCATGGTAGAGG + Intronic
1173425917 20:42943482-42943504 TCATGCCTGGCACCTGGGAGGGG - Intronic
1173809227 20:45946217-45946239 GCAGGCCAGTCCCCTCGTAGAGG - Exonic
1179881585 21:44295322-44295344 GGAAGCCTGTCACCTGCCCGGGG - Intronic
1181869937 22:25890226-25890248 GCATGCCTGTCACCTGCTAGAGG + Intronic
1181888711 22:26042155-26042177 GCCTGCCTGACACCTGGTGGGGG - Intergenic
1182045256 22:27269185-27269207 GCAAGCCTTTCTCCTGGTGAAGG - Intergenic
954215154 3:49120568-49120590 GCCAGCCTCCCACCTGGGAGAGG - Intronic
954864081 3:53714042-53714064 GAAAGCCTGTGACCTGTGAGAGG - Intronic
966661645 3:182420992-182421014 GCAAGCATGTCAGCTGGTCATGG - Intergenic
974361587 4:60887775-60887797 GGAAACCTGTCACCATGTAGTGG - Intergenic
985640092 5:1059547-1059569 GCACGGGGGTCACCTGGTAGCGG - Intronic
986127087 5:4893292-4893314 GCAAGGCTGCAGCCTGGTAGGGG - Intergenic
987753466 5:22069932-22069954 GCAAGCAACTCAGCTGGTAGTGG - Intronic
989284126 5:39679422-39679444 GCAAGCCTGTCATATGCTGGTGG - Intergenic
992392862 5:76345392-76345414 GCTAGACTGTAAGCTGGTAGAGG - Intronic
992407315 5:76472102-76472124 GCAAGTCTGGCACCTGGTTGAGG + Intronic
997395526 5:133556873-133556895 GCAAGCCCCTCACCTGGCAGTGG - Intronic
999659352 5:153842739-153842761 GCAAGCATGTCACATGGCAAGGG - Intergenic
999719049 5:154385245-154385267 ACAAGACTGGCACCTGGTAGGGG - Intronic
1000136895 5:158361712-158361734 ACAAACCTAACACCTGGTAGAGG - Intergenic
1007549785 6:42720451-42720473 GCAGACCTGTCACCTGGGAAGGG + Intronic
1010872687 6:81061805-81061827 GGAAGCCTGTCAAATGTTAGAGG + Intergenic
1013750712 6:113402639-113402661 GCAAGCATGTTACCTGGATGAGG - Intergenic
1015818022 6:137230386-137230408 GCAAACCAGCCACCTGGCAGGGG - Intergenic
1019707172 7:2502295-2502317 CCCAGCCTGTCCCCTGGTGGTGG + Intergenic
1024469177 7:49749322-49749344 GAAAGCCTTTCACCTTGCAGTGG - Intergenic
1028455164 7:91030630-91030652 GCAAGCCTGTCACCTGGTAGAGG + Intronic
1034610503 7:152363592-152363614 GAAAGCCTGTGCCATGGTAGGGG - Intronic
1039266033 8:35824813-35824835 GAAAGTCTGTCACATGGAAGAGG + Intergenic
1041373637 8:57190742-57190764 GCAAGCGTGTGAGCTGGTGGGGG + Intergenic
1043818427 8:84833015-84833037 GAAAGCCTGTCAAGTGGAAGAGG - Intronic
1047327212 8:123851386-123851408 GCAAACCTTTCAGCTGGTTGAGG + Intergenic
1052744543 9:32427357-32427379 ACTAGCCTGTCTCCTGGGAGTGG + Exonic
1053754625 9:41293084-41293106 TCAAGTCTGTCACCAGGTTGAGG - Intergenic
1054260147 9:62857388-62857410 TCAAGTCTGTCACCAGGTTGAGG - Intergenic
1054331623 9:63762617-63762639 TCAAGTCTGTCACCAGGTTGAGG + Intergenic
1056555525 9:87684292-87684314 GCAACACTGTCACCTGCCAGGGG + Intronic
1058971810 9:110090245-110090267 GAAATCCTGTGACCTGGCAGAGG + Intronic
1202798993 9_KI270719v1_random:155531-155553 TCAAGTCTGTCACCAGGTTGAGG + Intergenic
1190412591 X:50151645-50151667 GCAAGTCTGTAACCTGGAAGAGG + Intergenic
1195244185 X:102980839-102980861 GCAAGCCCATCACCTGGAAAGGG + Intergenic
1196155079 X:112419666-112419688 GTATGCCTGTCACCTGATTGGGG - Intergenic
1197274171 X:124459013-124459035 GAAAGCCTGGAAACTGGTAGAGG + Intronic
1202242926 Y:22789145-22789167 GCAGGCCAATCACCTGGTAGCGG + Intergenic
1202395913 Y:24422895-24422917 GCAGGCCAATCACCTGGTAGCGG + Intergenic
1202474872 Y:25247197-25247219 GCAGGCCAATCACCTGGTAGCGG - Intergenic