ID: 1028458930

View in Genome Browser
Species Human (GRCh38)
Location 7:91069994-91070016
Sequence GCAACCAGCTTGGCCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3419
Summary {0: 1, 1: 0, 2: 12, 3: 363, 4: 3043}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028458930_1028458935 11 Left 1028458930 7:91069994-91070016 CCTGTGTTGGCCAAGCTGGTTGC 0: 1
1: 0
2: 12
3: 363
4: 3043
Right 1028458935 7:91070028-91070050 CCCAAGCAATCCTCCCACCTCGG 0: 61
1: 2290
2: 7507
3: 18806
4: 40281
1028458930_1028458940 27 Left 1028458930 7:91069994-91070016 CCTGTGTTGGCCAAGCTGGTTGC 0: 1
1: 0
2: 12
3: 363
4: 3043
Right 1028458940 7:91070044-91070066 ACCTCGGCCTCCCAAAATGCTGG 0: 1510
1: 43417
2: 189034
3: 259565
4: 190195
1028458930_1028458942 28 Left 1028458930 7:91069994-91070016 CCTGTGTTGGCCAAGCTGGTTGC 0: 1
1: 0
2: 12
3: 363
4: 3043
Right 1028458942 7:91070045-91070067 CCTCGGCCTCCCAAAATGCTGGG 0: 4785
1: 137085
2: 283143
3: 212905
4: 222031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028458930 Original CRISPR GCAACCAGCTTGGCCAACAC AGG (reversed) Intronic
Too many off-targets to display for this crispr